Translator Disclaimer
1 June 2004 Field Survey of Sex-Reversals in the Medaka, Oryzias latipes: Genotypic Sexing of Wild Populations
Author Affiliations +
Abstract

The medaka, Oryzias latipes, has an XX/XY sex determination mechanism. A Y-linked DM domain gene, DMY, has been isolated by positional cloning as a prime candidate for the sex-determining gene. Furthermore, the crucial role of DMY during male development was established by studying two wild-derived XY female mutants. In this study, to find new DMY and sex-determination related gene mutations, we conducted a broad survey of the genotypic sex (DMY-negative or DMY-positive) of wild fish. We examined 2274 wild-caught fish from 40 localities throughout Japan, and 730 fish from 69 wild stocks from Japan, Korea, China, and Taiwan. The phenotypic sex type agreed with the genotypic sex of most fish, while 26 DMY-positive (XY) females and 15 DMY-negative (XX) males were found from 13 and 8 localities, respectively. Sixteen XY sex-reversals from 11 localities were mated with XY males of inbred strains, and the genotypic and phenotypic sexes of the F1 progeny were analyzed. All these XY sex-reversals produced XY females in the F1 generation, and all F1 XY females had the maternal Y chromosome. These results show that DMY is a common sex-determining gene in wild populations of O. latipes and that all XY sex-reversals investigated had a DMY or DMY-linked gene mutation.

INTRODUCTION

In vertebrates, the Y chromosome gene, SRY, has been identified as the testis-determining gene in mammals (Sinclair et al., 1990; Gubbay et al., 1990), however until recently, no equivalent gene or sex-determining genes had been identified in non-mammalian vertebrates. In the medaka, Oryzias latipes, which has an XX/XY sex-determining system (Aida, 1921), a Y-linked gene, DMY, was found to be a prime candidate for the sex-determining gene using positional cloning. DMY encoded a protein that contains a DM-domain, which was originally described as a DNA-binding motif found in two proteins, DSX and MAB-3, involved in sexual development in Drosophila melanogaster and Caenorhabditis elegans, respectively (Raymond et al., 1998). Vertebrates have also several DM-domain genes, and one of these, DMRT1 (DM-related transcription factor 1), has been implicated in male sexual development in mammals, birds, reptiles and fish (Raymond et al., 1999; Smith et al., 1999; De Grandi et al., 2000; Guan et al., 2000; Kettlewell et al., 2000; Marchand et al., 2000; Moniot et al., 2000). The cDNA sequences of medaka DMY and DMRT1 indicated the high similarity (83%) and DMY appears to have originated through a duplication event of an autosomal segment containing the DMRT1 region (Nanda et al., 2002).

DMY expression was observed only in genotypic (XY) males during gonadal sex differentiation, and a loss-of-function DMY mutation and depressed DMY expression mutation resulted in XY females (Matsuda et al., 2002). When a DNA fragment containing DMY was introduced as a trans-gene, testis developed in chromosomally (XX) female medaka (Matsuda et al., manuscript submitted for publication). These results demonstrate that DMY is both necessary and sufficient in determining testis formation in medaka. DMY is the first sex-determining gene to have been identified in non-mammalian vertebrates.

Sex-reversal mutants are important in revealing the molecular function of DMY and identifying other genes that are involved in sex determination. Analyses of these mutants allow us to extend our understanding of the function of genes and cell differentiation during sex determination. Two XY sex-reversed females with naturally occurring DMY mutations have already been found by screening wild medaka populations (Matsuda et al., 2002). This suggests that other spontaneous gene mutations involved in the sex-determining pathway can be identified from surveys in the wild.

A variety of sex-determining systems can coexist in closely related species or even within a single lower vertebrate species. Both the male-heterogametic XX/XY and female-heterogametic ZZ/ZW systems have been investigated within the Xiphophorus genus (reviewed in Volff and Schartl, 2001) and at the species level in Rana rugosa (Nishioka et al., 1993, 1994). Wild medaka populations comprise four genetically divergent groups (Sakaizumi, 1986; Sakaizumi and Joen, 1987; Sakaizumi et al., 1983), while the presence of DMY has been confirmed only in several medaka strains and wild populations classified in the Northern or Southern Populations (Matsuda et al., 2002). Therefore, it is possible that some populations have a sex-determining system that is not determined by DMY. On the other hand, artificial sex-reversals as a result of exogenous sex steroids (Yamamoto, 1953, 1958) or heat stresses (Gresik and Hamilton, 1977) have been reported in medaka. This suggests that in addition to the role of sex-determining genes, the natural environment might affect the phenotypic sex of wild medaka.

In this study, we conducted a broad survey of the DMY gene in wild medaka populations to locate any new gene mutations involved in the sex-determining pathway. Consequently, we report that approximately 1% of the wild medaka surveyed were sex-reversals and that all XY sex-reversals examined had a DMY or DMY-linked mutation.

MATERIALS 0D METHODS

Fish: We surveyed 2274 wild-caught fish at 40 localities throughout Japan (Table 1), collected from 2001 to 2003, and 730 fish from 69 wild stocks at the Faculty of Science, Niigata University. The wild stocks were collected from 55 localities in Japan (#41 to #95 in Table 2), 12 in Korea (#96 to #107), one in China (#108), and one in Taiwan (#109) between 1986 and 2001, and have been maintained thereafter.

Table 1

Phenotypic and genotypic sexes of the wild-caught medaka

i0289-0003-21-6-613-t01.gif

Table 2

Phenotypic and genotypic sexes of the wild stocks

i0289-0003-21-6-613-t02.gif

Sexing of the wild fish: Phenotypic sex was judged from secondary sex characters, namely, the shape of the dorsal and anal fins, and papillary processes on the male anal fin rays. Genotypic sex, XY or XX, was determined by the presence or absence of the DMY gene using PCR from caudal fin clip DNA extracted according to Shinomiya et al. (1999). PCR was performed with the following primers for DMY and DMRT1: PG17.5, CCGGGTGCCCAAGTGCTCCCGCTG, and PG17.6, GATCGTCCCTCCACAGAGAAGAGA at an annealing temperature of 55°C. PCR products were analyzed by electrophoresis in a 1% agarose gel. Other primers for DMY, ex3.1, GCAACAGAGAGTTGGATTTACGTCTCA, ex3.2, CTTTTGACTTCAGTTTGACACATCAATG, ex6.1, GTCATTAACACAACGCACAACAACTT, and ex6.2 AAAAACCAGAAGACCCGAGAGGAAG were also used (see Results). The positions of these primers in the DMY gene are shown in Fig. 1A.

Fig. 1

Genotypic sexing with PCR. (A) DMY structure of the Hd-rR.YHNI strain and positions of the primers used. Open boxes and horizontal lines indicate exons and introns respectively. Translation start and stop sites are shown by ATG and TGA. Numbers represent nucleotide sequence length (bp). The primer positions are illustrated by solid arrowheads. (B) One percent agarose gel electrophoresis of the DMY and DMRT1 PCR products. Individuals with only the DMRT1 band were judged XX (lanes 2, 4, 6, 8), while those with both DMRT1 and DMY bands were judged XY (lanes 3, 5, 7, 9).

i0289-0003-21-6-613-f01.gif

Progeny tests: All XY females from the wild populations were mated with XY males of an inbred strain, from either Hd-rR (Hyodo-Taguchi, 1996) or Hd-rR.YHNI (Matsuda et al., 1998). The F1 progeny from each pair were grown, and their phenotypic and genotypic sexes were determined. The DMY gene of the Northern Population had 21 nucleotide deletions in intron 2 compared to the Southern Population. Therefore, XY females from the Northern Population were mated with XY Hd-rR males (Southern Population), and those from the Southern Population were mated with XY Hd-rR.YHNI males, which had the HNI(Northern Population)-derived DMY gene. Four genotypes were distinguished in the F1 progeny (XX, XYm, XYp, YmYp; Ym, maternal and Yp, paternal) by separating the DMY PCR products with 10% vertical polyacrylamide slab gels in the buffer system of Davis (1964).

RESULTS

Genotypic sexing of wild populations

Since the nucleotide sequence of DMY is similar to that of DMRT1, many PCR primers can be used on both genes. For genotypic sexing, we used PG17.5 and PG17.6 primers and judged individuals with only the DMRT1 fragments to be XX (Fig. 1B, lane2, 4, 6, 8) and those with both DMY and DMRT1 fragments to be XY (Fig. 1B, lane3, 5, 7, 9). We also used two other DMY primer sets, ex3.1 and ex3.2 or ex6.1 and ex6.2, when males had only the DMRT1 fragments (XX males). In all such cases, no DMY fragments were detected (data not shown).

The PCR DMY products in most individuals were identified in the 1.0 kb vicinity on the 1% agarose gel, though the fragments were approximately 0.8 kb long in fish from Shin-cheon (#100 in Table 2) in Korea, and Kunming (#108) in China. In Gwangeui (#101), Korea, two DMY bands of 1.0 kb and 0.8 kb were identified (Fig. 1B).

The genotypic sex of the natural populations was investigated using 2274 wild-caught fish (Table 1). Of the females, 1174 (99.0%) were XX, while 12 (1.0%) from Aomori2 (#3), Aizu-wakamatsu (#8), Aizu-bange (#9), Kajikawa (#11), Shirone (#17), Suzu (#23), Awara (#26), and Kitakyushu (#38) were XY. Of the males, 1077 (99.0%) were XY, while 11 (1.0%) from Niigata2 (#15), Shirone (#17), Mito2 (#30), Kitakyushu (#38), and Mageshima (#40) were XX.

The 69 wild stocks investigated contained 11 stocks from the Northern Population, 38 from the Southern Population, six from the Hybrid Population (Sakaizumi, 1984), nine from the East Korean Population, and five from the China-West Korean Population (Table 2). XY females were identified in five stocks, Kurobe (#48), Kesennuma (#51), Saigo (#78), Aki (#83) and Oura (#90). While, XX males were found in 3 stocks, Teradomari (#43), Atsugi1 (#57) and Gwangeui (#101). A total of 14 XY females and 4 XX males were found in the wild stocks.

Progeny of the XY females

To clarify the cause of the XY sex-reversals, a total of 16 XY sex-reversals from 11 localities were mated with XY males of an inbred strain, either Hd-rR (females from #3, #8, #9, #17, #23, #26, and #48), or Hd-rR.YHNI (#51, #78, #83, and #90). The genotypic and phenotypic sexes of the F1 progeny were then analyzed (Table 3). All XX individuals in the F1 progeny from each pair were female and all XYp and YmYp were male, while all or some of the XYm were female. The XYm F1 from Aomori2 (#3), Aizu-bange (#9), Suzu (#23), Awara (#26), Kurobe (#48), Saigo (#78), Aki (#83) and Oura (#90) were all female, while the XYm F1 of Aizuwakamatsu (#8), Shirone (#17) and Kesennuma (#51) contained both males and females. In all crosses, the occur-rence of XY sex-reversals in the F1 progeny was linked to the maternal Y chromosome, while the paternal Y chromo-some derived from the inbred strains resulted in all F1 male individuals (XYp, YmYp).

Table 3

Genotypic and phenotypic sexes of the F1progeny from the XY females

i0289-0003-21-6-613-t03.gif

DISCUSSION

In the present study, we conducted a broad survey of the genotypic sex of a total of 3004 wild medaka from 109 localities covering the four genetically divergent groups of this species (Sakaizumi, 1986; Sakaizumi and Joen, 1987; Sakaizumi et al., 1983). Of the 1540 males, 1525 (99%) had the DMY gene (XY), while of the 1464 females, 1438 (96%) did not (XX). This intimate relationship between male and female gender and the presence or absence of the DMY gene strongly suggests that DMY is a common sex-determining gene in wild medaka populations.

Multiple fragment patterns were identified in the PCR products of DMY. In most populations a long fragment was detected, while individuals from Shincheon (#100) and Kunming (#108) had a short fragment. Fifteen out of 16 males from Gwangeui (#101) had both fragment types (Fig. 1B) (one male had no DMY fragments), indicating that the Gwangeui population had two DMY gene on the Y chromo-some. The short fragment was only detected in populations classified in the China-West Korean Population. Furthermore, molecular phylogenetic analysis of the DMY gene among the four major medaka groups demonstrated that the two types of DMY from the China-West Korean Population were most closely related. In XY males from Gwangeui with two types of DMY, only the short type was expressed at the sex-differentiating stage (Sato et al., in preparation).

The frequency of sex-reversed fish in wild-caught medaka was 1.0% (23 out of 2274, Table1), while 18 sex-reversals were found in eight of the 69 wild stocks (Table 2). All XY sex-reversals (n=16) produced XY females in their F1 progeny, demonstrating that all these sex-reversals resulted from a gene mutation involved in sex-determination. This suggests that XY sex-reversal resulted from environmental factors hardly occurs in natural habitats. All XY F1 females had maternally-derived DMY genes, indicating that the mutation was linked to the DMY gene. The mutant gene is inferred in DMY itself because DMY is the only functional gene in the Y-specific segment (Nanda et al., 2002).

Two types of XY sex-reversals existed with regards to the sex of the XY F1 progeny. Twelve out of 16 XY females produced an all-female XYm progeny, while four yielded both male and female XYm progenies. One XY female from Awara that produced an all-female XYm progeny (#26 in Table3) was found to have a DMY mutation causing a frameshift and premature termination of the DMY protein. Another XY female from Shirone that yielded a high proportion of XYm female offspring (#17) had reduced DMY expression (Matsuda et al., 2002). These results suggest that the XY females found in this study are a promising tool for gaining an understanding of the biochemical function and regulatory regions of the DMY gene, just as SRY mutants have in human studies (reviewed in Koopman, 2001; McElreavey et al., 1995; Vilain and McCabe, 1998). The sequences and expression patterns of the DMY gene of other XY sex-reversals are now under investigation.

In humans, approximately 15% of XY females have mutations in the coding region of SRY (Hawkins, 1995), and XY sex-reversals with mutations in other genes related to testis development have also been reported (reviewed in Ahmed and Hughes, 2002; Vilain and McCabe, 1998). On the other hand, all XY sex-reversals in medaka were linked to the DMY gene. A loss-of-function DMY mutation is thought to induce dominant sex-reversal in XY individuals, and furthermore, to be transmitted from XY females to their offspring because XY medaka females are fertile (Yamamoto, 1953) unlike mammals. DMY mutations might not be harmful and thus survive in natural habitats and wild stocks.

Fifteen XX males were observed in this survey. One of these XX males produced XX males in its backcross progeny, suggesting that XX sex-reversal results from a recessive mutation(s). We are now mapping the gene(s) that causes XX sex-reversal, which is expected to be involved in sex-determination.

Acknowledgments

This work was supported by a Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan (11236206) to M.S. This study was also funded by an LRI from the Japan Chemical Industry Association to S.H.

REFERENCES

1.

S. F. Ahmed and I. A. Hughes . 2002. The genetics of male under masculinization. Clin Endocrinol 56:1–18. Google Scholar

2.

T. Aida 1921. On the inheritance of color in a fresh-water fish, Aplocheilus latipes Temmick and Schlegel, with special reference to sex-linked inheritance. Genetics 6:554–573. Google Scholar

3.

D. A. Davis 1964. Disc gel electrophoresis-II. Method and application to human serum proteins. Ann NY Acad Sci 121:404–427. Google Scholar

4.

A. De Grandi, V. Calvari, V. Bertini, A. Bulfone, G. Peverali, G. Camerino, G. Borsani, and S. Guioli . 2000. The expression pattern of a mouse doublesex-related gene is consistent with a role in gonadal differentiation. Mech Dev 90:323–326. Google Scholar

5.

J. Gubbay, J. Collignon, P. Koopman, B. Capel, A. Economou, A. Munsterberg, N. Vivian, P. Goodfellow, and R. Lovell-Badge . 1990. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346:245–250. Google Scholar

6.

G. Guan, T. Kobayashi, and Y. Nagahama . 2000. Sexually dimorphic expression of two types of DM (Doublesex/Mab-3)-domain genes in a teleost fish, Tilapia (Oreochromis niloticus). Biochem Biophys Res Commun 272:662–666. Google Scholar

7.

E. W. Gresik and J. B. Hamilton . 1977. Experimental sex reversal in the teleost fish, Oryzias latipes. In “Handbook of Sexology”. Ed by J. Money and H. Musaph . Elsevier/North-Holland Biomedical Press. Amsterdam. pp. 107–126. Google Scholar

8.

J. R. Hawkins 1995. Genetics of XY sex reversal. J Endocrinol 147:183–187. Google Scholar

9.

Y. Hyodo-Taguchi 1996. Inbred strains of the medaka, Oryzias latipes. Fish Biol J Medaka 8:11–14. Google Scholar

10.

J. R. Kettlewell, C. S. Raymond, and D. Zarkower . 2000. Temperature-dependent expression of turtle Dmrt1 prior to sexual differentiation. Genesis 26:174–178. Google Scholar

11.

P. Koopman 2001. Sry, Sox9 and mammalian sex determination. In “Genes and mechanisms in vertebrate sex determination”. Ed by G. Scherer and M. Schmid . Brikhauser Verlag. Basel. pp. 25–56. Google Scholar

12.

O. Marchand, M. Govoroun, H. D'Cotta, O. McMeel, J. Lareyre, A. Bernot, V. Laudet, and Y. Guiguen . 2000. DMRT1 expression during gonadal differentiation and spermatogenesis in the rainbow trout, Oncorhynchus mykiss. Biochim Biophys Acta 1493:180–187. Google Scholar

13.

M. Matsuda, C. Matsuda, S. Hamaguchi, and M. Sakaizumi . 1998. Identification of the sex chromosomes of the medaka, Oryzias latipes, by fluorescence in situ hybridization. Cytogenet Cell Genet 82:257–262. Google Scholar

14.

M. Matsuda, Y. Nagahama, A. Shinomiya, T. Sato, C. Matsuda, T. Kobayashi, C. E. Morrey, N. Shibata, S. Asakawa, N. Shimizu, H. Hori, S. Hamaguchi, and M. Sakaizumi . 2002. DMY is a Y-specific DM-domain gene required for male development in the medaka fish. Nature 417:559–563. Google Scholar

15.

K. McElreavey, S. Barbaux, A. Ion, and M. Fellous . 1995. The genetic basis of murine and human sex determination: a review. Heredity 75:599–611. Google Scholar

16.

B. Moniot, P. Berta, G. Scherer, P. Sudbeck, and F. Poulat . 2000. Male specific expression suggests role of DMRT1 in human sex determination. Mech Dev 91:323–325. Google Scholar

17.

I. Nanda, M. Kondo, U. Hornung, S. Asakawa, C. Winkler, A. Shimizu, Z. Shan, T. Haaf, N. Shimizu, A. Shima, M. Schmid, and M. Schartl . 2002. A duplicated copy of DMRT1 in the sex-determining region of the Y chromosome of the medaka, Oryzias latipes. Proc Natl Acad Sci USA 99:11778–11783. Google Scholar

18.

M. Nishioka, H. Hanada, I. Miura, and M. Ryuzaki . 1994. Four kinds of sex chromosomes in Rana rugosa. Sci Rep Lab Amphib Biol Hiroshima Univ 13:1–34. Google Scholar

19.

M. Nishioka, I. Miura, and K. Saitoh . 1993. Sex chromosomes of Rana rugosa with special reference to local differences in sex-determining mechanism. Sci Rep Lab Amphib Biol Hiroshima Univ 12:55–81. Google Scholar

20.

C. S. Raymond, J. R. Kettlewell, B. Hirsch, V. J. Bardwell, and D. Zarkower . 1999. Expression of Dmrt1 in the genital ridge of mouse and chicken embryos suggests a role in vertebrate sexual development. Dev Biol 215:208–220. Google Scholar

21.

C. S. Raymond, C. E. Shamu, M. M. Shen, K. J. Seifert, B. Hirsch, J. Hodgkin, and D. Zarkower . 1998. Evidence for evolutionary conservation of sex-determining genes. Nature 391:691–695. Google Scholar

22.

M. Sakaizumi 1984. Rigid isolation between the Northern Population and the Southern Population of the medaka, Oryzias latipes. Zool Sci 1:795–800. Google Scholar

23.

M. Sakaizumi 1986. Genetic divergence in wild populations of the Medaka Oryzias latipes (Pisces: Oryziatidae) from Japan and China. Genetica 69:119–125. Google Scholar

24.

M. Sakaizumi and S. R. Joen . 1987. Two divergent groups in the wild populations of medaka Oryzias latipes (Pisces: Oryziatidae) in Korea. Korean J Limnol 20:13–20. Google Scholar

25.

M. Sakaizumi, K. Moriwaki, and N. Egami . 1983. Allozymic variation and regional differentiation in wild population of the fish Oryzias latipes. Capeia 1983:311–318. Google Scholar

26.

A. Shinomiya, M. Matsuda, S. Hamaguchi, and M. Sakaizumi . 1999. Identification of genetic sex of the medaka, Oryzias latipes, by PCR. Fish Biol J Medaka 10:31–32. Google Scholar

27.

A. H. Sinclair, P. Berta, M. S. Palmer, J. R. Hawkins, B. L. Griffiths, M. J. Smith, J. W. Foster, A. Frischauf, R. Lovell-Badge, and P. N. Goodfellow . 1990. A gene from the human sex-determining region encodes a protein with homology to conserved DNA-binding motif. Nature 346:240–244. Google Scholar

28.

C. A. Smith, P. J. McClive, P. S. Western, K. J. Reed, and A. H. Sinclair . 1999. Conservation of a sex-determining gene. Nature 402:601–602. Google Scholar

29.

E. Vilain and E. R. B. McCabe . 1988. Mammalian sex determination: from gonad to brain. Mol Genet Metab 65:74–84. Google Scholar

30.

J. N. Volff and M. Schartl . 2001. Variability of genetic sex determination in poeciliid fishes. Genetica 111:101–110. Google Scholar

31.

T. Yamamoto 1953. Artificially induced sex-reversal in genotypic males of the medaka (Oryzias latipes). J Exp Zool 123:571–594. Google Scholar

32.

T. Yamamoto 1958. Artificial induction of functional sex-reversal in genotypic females of the medaka (Oryzias latipes). J Exp Zool 137:227–263. Google Scholar
Ai Shinomiya, Hiroyuki Otake, Ken-ichi Togashi, Satoshi Hamaguchi, and Mitsuru Sakaizumi "Field Survey of Sex-Reversals in the Medaka, Oryzias latipes: Genotypic Sexing of Wild Populations," Zoological Science 21(6), 613-619, (1 June 2004). https://doi.org/10.2108/zsj.21.613
Received: 9 February 2004; Accepted: 1 March 2004; Published: 1 June 2004
JOURNAL ARTICLE
7 PAGES


SHARE
ARTICLE IMPACT
Back to Top