Population Dynamics

Mythimna separata moth populations were monitored daily by a network of ground light-traps placed in three regions (Gongzhuling, Meihekou, Taonan) of Jilin Province. The ground lighting units consisted of automatic light-traps (Jiaduo Group, Hebi, Henan, China) configured with a 20-W black-light lamp. The lights turned on at sunset and off at sunrise between 2011 and 2019. Data were counted between mid-May and late August each year. Food-lure traps were used to monitor M. separata moth populations in Gongzhuling (Fig. 2). The food-lure contained a mixture of liquor, water, brown sugar, vinegar, and trichlorfon (Chen et al. 1989). From the food-lure trap catch, a total of 15 female individuals were randomly selected and dissected every other day in July from 2014 to 2019. Ovarian dissection is an effective method of determining migratory insects' status (Riley et al. 1995, Feng et al. 2004), which has been shown to work well in M. separata moths (Feng et al. 2008). Low level of ovarian development and mating rate indicates that adult moths are newly emerged locally or are immigrants. By contrast, high level of ovarian development and mating rate indicated that the moths are breeding locally, though it does not provide information on whether they emerged locally or were immigrants. The level of ovarian development was estimated according to the criteria described below. Stage 1, transparent and light milky-white ovary and no follicular differentiation; Stage 2, presentation of developing eggs; Stage 3, presentation of mature eggs; Stage 4, some eggs have been laid; Stage 5, the ovary is atrophied, and most eggs have been laid. Mating occurrences were determined by the presence of a spermatophore in the female spermatheca. Field survey reports on the third-generation outbreak regions (Fusong, Jiutai, and Yongji) in 2017 were obtained from Jilin Provincial Agro-Tech Extension Center.

Fig. 2.

Ovarian development status of female Mythimna separata moths in the food-lure traps during the migration period. (a) The food-lure trap. Twelve rectangular holes (L: 20 cm, W: 1.5 cm) were located around the cylindrical steel trap. (b) Ovarian development status. (c) Mating rates. Data of 2014 and 2016 were uncounted due to low female numbers. 1: 15 July 2015 to 23 July 2015; 2: 24 July 2015 to 1 August 2015; 3: 9 July 2017 to 17 July 2017; 4: 18 July 2017 to 26 July 2017; 5: 18 July 2018 to 26 July 2018.

Radar Observations

Observations of insect flight paths were made using the Jilin Academy of Agricultural Sciences (JAAS) Entomological Radar, China's first entomological radar. It was built in 1982 and updated in cooperation with Wuxi Leyoung Electronics Technology Co., Ltd. (Wuxi, Jiangsu, China). The migration paths of Loxostege sticticalis (L.) (Lepidoptera: Crambidae) and Dendrolimus tabulaeformis Tsai & Liu (Lepidoptera: Lasiocampidae) were accurately observed by this radar system in the 1980s and 1990s (Cheng et al. 2005), and it has proven effective for directly observing first and second-generation adults of M. separata in migration high above the ground (Chen et al. 1989, 1995). Several methods have been used to identify radar observation targets as M. separata. (1) Characteristics of the echoes and of the observed flight behaviours, as observed during previous radar studies (Riley et al. 1995, Feng et al. 2008, Drake and Reynolds 2012, Zhang et al. 2013). (2) Catching insects by light-trap, which indicated that M. separata was the most abundant macro insect species during the period. There was a positive correlation between radar echoes and M. separata catch numbers (Sun et al. 2016). Therefore, M. separata was thought to be the dominant species on the radar's plan-position indicator (PPI) display. (3) Detection of noctuid moths, including M. separata, by aerial sampling (Chen et al. 1989).

The JAAS radar uses a scanning pencil-beam radar, transmitting at a frequency of 9,340 ± 30 MHz (X-band, wavelength 3.2 cm), pulse length 0.1 µs, peak power 10 kW, and pulse repetition frequency 500 Hz. The antenna is a 1.5-m diameter parabolic dish (beam width 1.5°), with an elevation angle variable from –2° to 60° and a scan rate of 15 revolutions/min; polarization is horizontal. Radar echoes appear on a PPI display which can be adjusted to show maximum ranges of 2, 5, or 10 km. Data acquisition and display system was employed to capture and store the PPI screen image, with migration parameters of the M. separata moths being extracted by automated systems (Cheng et al. 2005). The radar was operated using angles of 15°, 30°, and 45° with each angle scanned for 30 s. The repeat interval of the whole process was set to 12 min. All recorded observations were made from sunset through sunrise during July 2017. This study was carried out at Gongzhuling experimental station of JAAS (43°31′69″N, 124°49′28″E), located centrally in Jilin Province.

Analysis of Meteorology and Insect Trajectories

Based on the radar-collected data, the flying height of M. separata adults was close to that of the 925 hPa pressure level (approximately 500 m height). Meteorological data for this level, including temperature and u- and v-winds, were therefore obtained from the National Center for Atmospheric Research (NCAR, USA) and National Centers for Environmental Prediction (NCEP, USA). Daily rainfall data were downloaded from the National Meteorological Information Center (China). Field temperature and humidity were recorded using HOBO data loggers in each of the three monitoring regions (Onset Computer Corporation, MA). The geographical destination and source area of the migrating moths were estimated via constructed trajectories carried out by the Hybrid Single Particle Lagrangian Integrated Trajectory (HYSPLIT) facility (Stein et al. 2015, Rolph et al. 2017). HYSPLIT is a professional model for computing simple air parcel trajectories that has previously been employed to simulate insect migratory trajectories (e.g., Westbrook et al. 2019, Wainwright et al. 2020) and specifically to investigate likely source and destination regions (Rosenberg and Magor 1983, Dingle 1996, Chapman et al. 2010, Zhang et al. 2018). The trajectory simulations were based on the following assumptions: (1) the moths flew approximately downwind (Chen et al. 1989); (2) they remained at the altitude of the 925 hPa level; (3) wind speed was assumed to be the moths' flight speed, flights lasted 8 hr (from 19:00 to 03:00, Beijing local time), and; (4) flights continued for up to five successive nights.

Table 1.

Details of the samples examined in this study of populations of Mythimna separata

MtDNA Analysis

Sampling: A total of 19 populations, including 6 populations of second-generation (I) and 13 populations of third generation (II) M. separata were sampled in maize fields across Jilin Province between June and August in 2017 (Table 1). In all, 546 individuals were captured, all as larvae except at Taonan (where 7 adults and 7 larvae were obtained). Three of the samples (Fusong, Jiutai, and Yongji) were from third-generation outbreak populations. Specimens were immediately killed and preserved in absolute ethanol for their subsequent DNA extractions.

MtDNA Extraction: Genomic DNA was extracted from the whole insect body, by using a genomic DNA purification kit (Dingguo Co., Ltd, Beijing, China). A 676-bp COI fragment of mitochondria was amplified using primer pairs (F: TTCGAGCTGAATTAGGAACCC, R: CTTTCTTGGGAAATAATGTGAGAAA). This fragment contains a portion of the fast-evolving COI region, which is known to be suitable for low-level phylogenetic investigations and is applicable to population genetic studies (Lunt et al. 1996).

PCR: PCR amplifications were carried out with 25 µl of the 2×Taq PCR mix (Dingguo Co., Ltd, Beijing, China), 1 µl of each primer (10 µm), 1 µl of DNA template in a 50-µl reaction mixture topped with molecular grade water. The thermal cycling conditions consisted of initial denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 40 s, followed by a final extension at 72°C for 10 min. These amplifications were conducted in a PCR-Cycler ABI 9700, and the purified products were sequenced on an ABI 3730 automatic sequencer (Applied Biosystems, Foster City, CA).

Statistical Analyses

Sampling date denotes the evening of that day through to sunrise of the next day. Meteorological data were processed and checked in ‘Grads’ software (Kalnay et al. 1996). ArcGIS v10.2 was used to construct the trajectory images. Monitoring data computations were carried out in Excel 2003. Figures were drawn in Origin v8.5 software. The COI gene partial sequences were edited using the Chromas tool. Sequences were identified by comparing them with already submitted sequences obtained from the NCBI database. All the sequences alignments and assembly were done by DNAMAN software. Mega v4.0 (Tamura et al. 2007) was used to analyze the nucleotide composition, the variable sites, transition, and transversion, for which distances for haplotypes were calculated according to the K-2-P model. The neighbor-joining (NJ) phylogenetic tree was also built in this software. To depict geographical associations of the M. separata populations, a haplotype network was created using Network v4.6.1.1 based on the median-joining method (Bandelt et al. 1999).

Population Dynamics

The M. separata occurrence period can be divided into two main parts: the period of spring immigration of moths (first-generation moths) and the period of second-generation moths (Fig. 3). Moths of the spring migration were regularly captured from early May to late June, their abundance peaking from early to mid June. The second-generation moths were regularly captured from early July to mid August, peaking from mid to late July. In 2017, the second-generation moths appeared earlier than in other years, showing a peak from early to mid July. Compared with the first-generation moths, the numbers of second-generation moths were relatively high in 2012, 2015, and 2017.

Fig. 3.

Daily variation in the number of Mythimna separata moths in the ground light-traps between 2011 and 2019. (a) Gongzhuling, (b) Meihekou, (c)Taonan.

Results of ovarian dissection showed that the moth population was a mixture of locally emerged moths and immigrants in July (Fig. 2). This finding was confirmed by the following evidence. Analysis was divided into earlier period (15 July 2015 to 23 July 2015, 9 July 2017 to 17 July 2017) and later period (24 July 2015 to 1 August 2015, 18 July 2017 to 26 July 2017). For the earlier period, the female moths had evidently undergone a low level of ovarian development and experienced a low mating rate (Fig. 2), indicating that this population consisted of new locally-emerged moths, recent immigrants, or a mix of the two. By contrast, female moths caught in the later period were in various stages with a high mating frequency (Fig. 2). They were therefore a mix of newly emerged moths and older moths that had commenced local breeding; as with the earlier population, the ovarian data does not reveal whether these moths had emerged locally or were in immigrants.

Analysis of Meteorology

According to the meteorological data, the temperature at 925 hPa ranged from 20–30°C, well above the threshold temperature required for the moths' take off (8°C) (Zhang and Li 1985). During the peak periods, wind speeds ranged between 1 and 20 m/s, averaging 9.9 m/s, which is more than double the moths' flight speed of 4 m/s (Chen et al. 1995); hence, the tracked moths will have moved approximately downwind. The winds come from a variety of directions, and southwesterly winds account for 75% of the total. Significant amounts of rainfall occurred on 9–10, 13–16, and 19–21 July, and these heavy rains suppressed moth emigrations.

Radar Observation and Insect Trajectory

Most of the targets were concentrated at a height of 600 m above ground level, with an 800 m maximum height, reached on some nights. The moths migrated frequently, and observation of the radar's PPI display indicated that they were often concentrated in a high-density layer. These layers were found mainly at heights of 350 m to 800 m. Winds were predominantly southwesterly during this period. Northward immigrations were detected twice during the migration period in 2017. On July 14, few echoes were detected in the early observations on the PPI display. A layer between heights of 450 and 800 m was detected at 4:34 hr on 15 July (Fig. 4a), indicating that migrants moved northwards. Wind direction was southwesterly (Fig. 5a). Afterward, the layer disappeared, indicating the end of migration. The number of moths caught in the light trap was high that night, which indicated an immigrant population. The second observation was similar to the first one. A layer was observed between heights of 400 and 700 m at 4:27 hr on 17 July 2017 (Fig. 4b). These migrants were also moving northwards, riding southwesterly winds (Fig. 5b). The ceased observation indicated the end of migration. The number of moths caught was again relatively high that night, and the population was assumed to be immigrants. These immigrants had two possible destinies: to terminate their migration and be the source of a third-generation population in Jilin; or to continue their journey, departing on the next suitable night. Possible source areas were calculated by trajectory analysis following the immigrant moths' observations. The endpoints of backward trajectories of one or two nights were mainly in Liaoning Province, and the endpoints of the five-night trajectories were as far as Shandong Province (Fig. 6A).

Fig. 4.

Photograph of radar PPI display strong layer concentration of Mythimna separata migration. (a) The layer extends between altitudes of 450–800 m at 4:34 hr on 15 July, 2017. (b)The layer extends between altitudes of 400–700 m at 4:27 hr on 17 July, 2017. The elevation angle was 30°. The distance to the edge of the display was 2 km. The image shows three successive scans of the antenna, with each scan recorded in a different color. A single color, therefore, represents a moving echo. If a target is detected in the same place on all three scans, the colors will superimpose and appear white. The mass of white echo around the center is due to immobile surface structures.

Fig. 5.

Wind fields during the migration of Mythimna separata. (a) Wind field on the 925 hpa level at 02:00 15 July, 2017, (b) Wind field on the 925 hpa level at 02:00 17 July, 2017.

Based on analysis of immigrants, we estimated the source areas for M. separata populations that reached the outbreak region. In 2017, some areas of Jilin Province experienced heavy rains. Afterward, third-generation larvae caused significant yield losses. Although damage by third-generation larvae in outbreak regions (Fusong, Jiutai, Yongji) was serious, damage by second-generation larvae there was light. Therefore, we infer that heavy rain caused immigrants to land and prevented locally emerged adult moths and immigrants from taking off at dusk. Then, the retained moths laid eggs, and a subsequent generation of larvae arose. The migration period of the immigrant moths was analyzed. The oviposition date was inferred from the observed local stage using the effective accumulated temperature. The result showed that the dates when the ovipositing moths arrived coincided with the earlier period (9 July 2017 to 17 July 2017) of the second-generation moths. In combination with the date of heavy rainfall in the outbreaking areas, immigrant moths from 10 to 14 July 2017 were considered to be a major component of immigration. We calculated backward trajectories starting on these dates. Based on simulation periods from 1 to 5 d, the source regions were in northeast, central, and southern China (Fig. 7). The endpoints of backward trajectories with one or two nights were mainly in Liaoning Province, and the endpoints of five-night trajectories were as far away as Anhui and Shandong Provinces. However, migration for 1 or 2 d seems much more likely than a 5-d flight.

Fig. 6.

Trajectory analyses for the nights when the radar showed immigration and emigration of the moths. (A): Backward trajectories for immigration on July 15 and 17, 2017. (B): Forward trajectory for emigration on July 27, 2017. a: 7–15, b: 7–17, c: 7–27. * Starting point ▲ First night endpoint ■ Second night endpoint • Fifth night endpoint.

Fig. 7.

Source regions of second-generation Mythimna separata moths led to the outbreak in 2017. (A)The backward trajectories from July 10 to 14 in FS (Fusong). (B)The backward trajectories from July 10 to 14 in JT (Jiutai). (C)The backward trajectories from July 10 to 14 inYJ (Yongji). a: 7–10, b: 7–11, c: 7–12, d: 7–13, e: 7–14. * Starting point ▲ First night endpoint ■ Second night endpoint • Fifth night endpoint.

The radar revealed that M. separata moths begin to take flight just after dusk. The earliest layer that formed was detected at 19:52 hr, and identified as an ‘emigration population’. The layer was observed between the heights of 350 and 550 m on 27 July 2017. The possible destination region was analyzed following the observation. The forward trajectory of one or two nights reached Liaoning Province, and the forward trajectory with a five-night trajectory reached the central part of Jilin Province (Fig. 6B). The plotted forward trajectories indicated that nonretained moths originating in Gongzhuling could migrate into Jilin and Liaoning Provinces and even into Russia; moths from Meihekou could migrate into Liaoning Province as well as Russia; moths from Taonan could migrate most widely, into Russia, Inner Mongolia, and both Jilin and Heilongjiang Provinces. The trajectories for the number of moths were high (Gongzhuling, July 10–12 and 14–15; Meihekou, July 10–15; and Taonan, July 15–20) as shown in Fig. 8. The forward trajectories with one or two nights were primarily in northern China, whereas the forward trajectories with five nights could reach as far as Russia. The destinations were locations that are very cold winter, where no host plants for the pest are available. This analysis showed that these moths eventually landed in regions where they could not overwinter.

Mitochondrial DNA Analysis

A 605-bp fragment of the Mitochondrial DNA (MtDNA) COI was successfully amplified and edited in all samples. No insertions or deletions were observed, and its alignment showed the COI fragment contained 562 conserved sites and 43 variable sites; this included 22 parsimonious informative sites and 21 single variable sites. The average nucleotide sequence was as follows: 29.1% of A, 42.7% of T, 14.5% of C, and 13.7% of G. This high A+T content (71.8%) agrees with values for other insects. Of the 44 base substitutions present, a total of 41 were transition and 3 were transversion types, with most of the former being C–T, and the overall transition/ transversion bias was R = 26.7.

The variable sites were distinguished by 69 different haplotypes (H1, H3–H6, H8, H10–12, H16, H18–76), whose corresponding sequences were submitted to GenBank database (under accession nos. MH 900379, 900381–900384, 900386, 900388–900390, 900394, 900396–900454). The average genetic distance of these different haplotypes was 0.005 (range: 0.002–0.013). The dominant haplotype, H1, accounted for 50.91% of all the sampled specimens, and it was widespread in each population. The second most common haplotype was H3 (18.86%), and it was also found in all 19 populations. The third most common, H8 (6.41%), was found in 14 of the 19 populations. Twenty-two shared haplotypes were found, while the remaining 47 haplotypes were unique. Twenty-nine haplotypes were present in the second generation, of which 10 were shared, leaving 19 unique haplotypes identified. Fifty-seven haplotypes were present in the third generation, of which 19 haplotypes were shared and 38 unique. Ten haplotypes were shared by the two generations. As the first generation was sampled as larvae, this indicates that locally emerged moths had bred locally. The unique haplotypes were detected in both generations, suggesting emigration and immigration had both occurred.

Fig. 8.

Destination regions during the peak migration period of second-generation moths. (A) Forward trajectories from July 10 to 12 and 14 to 15 starting at GZL (Gongzhuling). (B) Forward trajectories from July 10 to 15 from MHK (Meihekou). (C) Forward trajectories from July 15 to 20 fromTN (Taonan). a: 7–10, b: 7–11, c: 7–12, d: 7–13, e: 7–14, f: 7–15, g: 7–16, h: 7–17, i: 7–18, j: 7–19, k: 7–20. * Starting point ▲ First night endpoint ■ Second night endpoint • Fifth night endpoint.

The phylogenetic network was complicated and no geographical pattern could be detected from it (Fig. 9). Valid data are briefly discussed below. Samples collected in the same location between two generations had the same haplotype (H12); likewise, some samples collected in the outbreak regions shared the same haplotypes (H36, H57). From the built NJ tree, no significant geographical clusters were found that corresponded to the sampling locations. Nonetheless, these results did indicate that moths from the same locations had closely related haplotypes; for example, the clade formed by H12 and H32, with a high support value (53%), came from the GZL-I population, and the clade formed by H72 and H75 (77%) came from the MHK-II population. Closely related haplotypes were present in locations nearer to each other; for example, the clade containing H37 (HLH-II) and H41 (NA-II) had a high bootstrap value (53%). Furthermore, the cluster consisting of H6 (KQS-II), H65 (FSF-II), and H54 (KQF-II), as well as that consisting of H35 (JT-II) and H62 (FSF-II), all originated from outbreaking populations (Fig. 10). Collectively, same (H36 and H57) and closely related (H6, H65, and H54; H35 and H62) haplotypes were obtained from the third-generation outbreaking populations, indicating a common region of origin.