Open Access
Translator Disclaimer
1 March 2004 SIMULTANEOUS DETECTION OF VAIRIMORPHA INVICTAE (MICROSPORIDIA: BURENELLIDAE) AND THELOHANIA SOLENOPSAE (MICROSPORIDIA: THELOHANIIDAE) IN FIRE ANTS BY PCR
Steven M. Valles, David H. Oi, Juan A. Briano, David F. Williams
Author Affiliations +

Microsporidia are obligate intracellular protozoan parasites of eukaryotes (Mathis 2000). Two species of microsporidia, Thelohania solenopsae (Knell et al. 1977) and Vairimorpha invictae (Jouvenaz and Ellis 1986) have been reported to be effective biological control agents against the fire ant, Solenopsis invicta (Williams et al. 1999, Briano and Williams 2002). Unfortunately, because the life cycles of these pathogens remain unknown, diagnosis is principally limited to microscopic examination of ant homogenates for the characteristic spore stage. This limitation has hampered epidemiological studies, the elucidation of potential intermediate hosts, and description of the complete life cycle. While a number of PCR-based methods have been developed for detection of T. solenopsae (Snowden et al. 2002, Valles et al. 2002) none are available for V. invictae. By exploiting nucleotide sequence differences in the 16S rRNA genes of T. solenopsae and V. invictae, we provide a PCR-based method capable of detecting infection of fire ants by either pathogen.

V. invictae-infected colonies of S. invicta were collected in Argentina (near San Javier, Santa Fe Province) in April 2003. Infections were determined by the observation of V. invictae spores in wet mount preparations of macerated adult ants under a phase-contrast microscope (400X, Briano and Williams 2002). In addition, 1 S. invicta (Santa Fe Province) and 2 S. richteri (Entre Rios Province) colonies with dual infections (V. invictae and T. solenopsae) were collected in Argentina in April 2003. S. invicta were keyed to species (Trager 1991) and verified as “invicta-like” by chemotaxonomy (Vander Meer and Lofgren 1990). Genomic DNA was extracted from adult ants as described by Valles et al. (2002).

PCR was carried out with primer pairs specific for the 16S rRNA gene of T. solenopsae (p1, 5’CGAAGCATGAAAGCGGAGC and p2, 5’CAGCATGTATATGCACTACTGGAGC) and V. invictae (p90, 5’CACGAAGGAGGATAACCACGGT and p93, CGCAATCAGTCTGTGAATCTCTTCA). The microsporidian-specific primers were designed by aligning the T. solenopsae (accession number AF 134205) and V. invictae 16S rRNA gene sequences with the Vector NTI 7.1 program (Informax, Inc., Bethesda, MD) and choosing unique areas from each species. A published nucleotide sequence for the 16S rRNA gene was available in GenBank for a Vairimorpha sp. thought to be V. invictae (accession number AF031539). To verify that this sequence corresponded to the V. invictae 16S rRNA gene, we amplified a fragment of the gene from V. invictae with primers p90 and p93. The 791 bp amplicon was purified by separation on a 1.2% agarose gel, ligated into pGEM-T easy (Promega, Madison, WI), and used to transform Solopack Gold supercompetent E. coli DH5a cells (Statagene, La Jolla, CA). Insert-positive clones were sequenced by the Interdisciplinary Center for Biotechnology Research, University of Florida. Three replicates were sequenced.

PCR was conducted by the hot start method in a PTC 100 thermal cycler (MJ Research, Waltham, MA) under the following optimized temperature regime: 1 cycle at 94°C for 2 min, then 35 cycles at 94° C for 15 sec, 55°C for 15 sec, and 68°C for 45 sec, followed by a final elongation step of 5 min at 68°C. The reaction was conducted in a 50-μl volume containing 2 mM MgCl2, 200 μM dNTP mix, 1 unit of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA), 0.4 μM of each primer, and 0.5 μl of the genomic DNA preparation (10 to 100 ng). PCR products were separated on a 1.2% agarose gel and visualized by ethidium bromide staining. For all experiments, positive and negative controls were run alongside treatments.

The fragment of the 16S rRNA gene that we amplified from V. invictae (host S. invicta) was identical to the sequence reported previously by Moser et al. (1998). Despite being found in S. richteri, they suspected that the microsporidian with which they were working was V. invictae. Indeed, Briano et al. (2002)reported that T. solenopsae and V. invictae could infect either ant species, S. invicta or S. richteri. This conclusion was confirmed by successful detection of V. invictae from S. invicta and S. richteri with V. invictae-specific primers, p90 and p93.

Figure 1 demonstrates the specificity of the primer pairs for each species 16S rRNA gene. As reported by Valles et al. (2002), the T. solenopsae-specific primer pair, p1 and p2, produced a 318 bp amplicon exclusively from T. solenopsae-infected S. invicta (column 2). Similar specificity was observed for the 16S rRNA gene of V. invictae with primers p90 and p93; a 791 bp amplicon was produced exclusively from V. invictae-infected S. invicta (column 5). In cases where an ant colony was infected with both organisms, each microsporidian species could be discerned in a single multiplex reaction containing both primers sets (Fig. 1, lanes 6 and 7). Again, V. invictae was successfully detected in either S. invicta or S. richteri.

Microscopic detection of these microsporidia is labor intensive and limited to known stages of development. The multiplex PCR method to detect T. solenopsae and V. invictae offers a number of advantages over traditional microscopy, including, increased sensitivity, specificity, and the ability to identify all developmental stages. Thus, multiplex PCR decreases the risk of misidentification and will facilitate epizootiological studies concerned with these pathogens.

We thank Chuck Strong for technical assistance and R. Vander Meer for identifying the ant species by gas chromatography. We also thank R. M. Pereira and J. L. Capinera who provided helpful reviews of a previous version of the manuscript.

Summary

A PCR-based method capable of detecting Thelohania solenopsae and/or Vairimorpha invictae infection in the red imported fire ant, Solenopsis invicta, was developed. Multiplex PCR allows simultaneous detection of both species of microsporidia in a single reaction.

References

1.

J. A. Briano and D. F. Williams . 2002. Natural occurrence and laboratory studies of the fire ant pathogen Vairimorpha invictae (Microsporida: Burenellidae) in Argentina. Environ. Entomol. 31:887–894. Google Scholar

2.

J. A. Briano, D. F. Williams, D. H. Oi, and L. R. Davis Jr . 2002. Field host range of the fire ant pathogens Thelohania solenopsae (Microsporida: Thelohaniidae) and Vairimorpha invictae (Microsporida: Burenellidae) in South America. Biol. Control 24:98–102. Google Scholar

3.

D. P. Jouvenaz and E. A. Ellis . 1986. Vairimorpha invictae n. sp. (Microspora: Microsporidia), a parasite of the red imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae). J. Protozool. 33:457–461. Google Scholar

4.

J. D. Knell, G. E. Allen, and E. I. Hazard . 1977. Light and electron microscope study of Thelohania solenopsae n. sp. (Microsporida: Protozoa) in the red imported fire ant, Solenopsis invicta. J. Invertebr. Pathol. 29:192–200. Google Scholar

5.

A. Mathis 2000. Microsporidia: emerging advances in understanding the basic biology of these unique organims. Int. J. Parasitol. 30:795–804. Google Scholar

6.

B. A. Moser, J. J. Becnel, J. Maruniak, and R. S. Patterson . 1998. Analysis of the ribosomal DNA sequences of the microsporida Thelohania and Vairimorpha of fire ants. J. Invertebr. Pathol. 72:154–159. Google Scholar

7.

K. F. Snowden, K. Logan, and S. B. Vinson . 2002. Simple, filter-based PCR detection of Thelohania solenopsae (Microspora) in fire ants (Solenopsis invicta). J. Eukaryot. Microbiol. 49:447–448. Google Scholar

8.

J. C. Trager 1991. A revision of the fire ants, Solenopsis geminata group (Hymenoptera: Formicidae: Myrmicinae). J. New York Entomol. Soc. 99:141–198. Google Scholar

9.

S. M. Valles, D. H. Oi, O. P. Perera, and D. F. Williams . 2002. Detection of Thelohania solenopsae (Microsporidia: Thelohaniidae) in Solenopsis invicta (Hymenoptera: Formicidae) by multiplex PCR. J. Invertebr. Pathol. 81:196–201. Google Scholar

10.

R. K. Vander Meer and C. S. Lofgren . 1990. Chemotaxonomy applied to fire ant systematics in the United States and South America. pp. 75-84. In R. Vander Meer, K. Jaffe and A. Cedeno [eds.]. Applied myrmecology, a world perspective. Westview Press, Boulder, CO. 741 pp. Google Scholar

11.

D. F. Williams, G. J. Knue, and J. J. Becnel . 1999. Discovery of Thelohania solenopsae from the imported fire ant, Solenopsis invicta, in the United States. J. Invertebr. Pathol. 71:175–176. Google Scholar

Appendices

Fig. 1.

Banding patterns on a 1.2% agarose gel after multiplex PCR with 16S rRNA-specific oligonucleotide primers. Column 1, molecular weight markers expressed as base pairs (bp);, column 2, DNA prepared from T. solenopsae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific); column 3, DNA prepared from T. solenopsae-infected S. invicta, oligonucleotide primers p90 and p93 (V. invictae-specific); column 4, DNA prepared from V. invictae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific); column 5, DNA prepared from V. invictae-infected S. invicta, oligonucleotide primers p90 and p93 (V. invictae-specific); column 6, mixture of DNA prepared from V. invictae-infected S. invicta and T. solenopsae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific), and p90 and p93 (V. invictae-specific); column 7, DNA prepared from T. solenopsae- and V. invictae-infected S. invicta, oligonucleotide primers p1 and p2 (T. solenopsae-specific), and p90 and p93 (V. invictae-specific); column 8, DNA prepared from uninfected S. invicta, oligonucleotide primers p1 and p2, and p90 and p93.

i0015-4040-87-1-85-f01.gif
Steven M. Valles, David H. Oi, Juan A. Briano, and David F. Williams "SIMULTANEOUS DETECTION OF VAIRIMORPHA INVICTAE (MICROSPORIDIA: BURENELLIDAE) AND THELOHANIA SOLENOPSAE (MICROSPORIDIA: THELOHANIIDAE) IN FIRE ANTS BY PCR," Florida Entomologist 87(1), 85-87, (1 March 2004). https://doi.org/10.1653/0015-4040(2004)087[0085:SDOVIM]2.0.CO;2
Published: 1 March 2004
JOURNAL ARTICLE
3 PAGES


Share
SHARE
RIGHTS & PERMISSIONS
Get copyright permission
Back to Top