Trophic placement of an organism is important to understanding its evolutionary history, phylogenetic relatedness to other organisms, and how it coexists with other members of its community. One factor that influences the trophic behavior of an organism is its symbiotic relationships with beneficial microbes. Certain endosymbionts contribute a range of nutritional benefits to their host. In insects, these contributions include synthesis of essential nutrients, production of vitamins and sterols, processing of foods such as cellulose, food detoxification, and determination of food utilization (Douglas 2009). Often when an insect's diet lacks essential nutrients, endosymbionts play pivotal roles in providing the host with the limited nutrients. Blood-feeding insects are a good example of insects living on a nutrient-limited diet in which endosymbionts supplement essential vitamins for the host's survival (Pais et al. 2008; Hosokawa et al. 2010). This phenomenon of nutritional upgrading is not exclusive to bloodfeeding insects. In the ominivorous carpenter ant Camponotus floridanus (Buckley) (Hymenoptera: Formicidae) the gut endosymbiont Blochmannia floridanus provides essential amino acids thought to contribute to the ant's nutrition when those amino acids cannot be found in the environment (Feldhaar et al. 2007). A major problem that omnivorous insects face is breaking down and digesting tough plant material. In the cricket Acheta domesticus (L.) (Orthoptera: Gryllidae), the gut microbial community helps to digest carbohydrate oligomers and polymers, leading to faster growth rates, quicker maturation, larger adult body size, and greater egg production (Kaufman & Klug 1991).

Seeds are a common part of many insects' diet. Insects have developed a number of adaptations to consume and digest seeds. Some key adaptations that determine rate of granivory could be categorized as morphological, physiological, or enzymatic (Lundgren 2009). Mandibular structure and size is one key morphological adaptation which determines seed consumption. For example granivorous/herbivorous carabids have evolved a large retinacular ridge on their mandible, which is used to grind seeds (Acorn & Ball 1991). Also, the mandibles of granivorous carabids tend to be more quadrate in shape than those found in predaceous species, and they are often asymmetric (Acorn & Ball 1991; Arndt & Kirmse 2002). Also, the psamnophore in harvester ants is a morphological adaptation used to carry seeds (Brown et al. 1979). Size of the insect also affects seed selection; all else being equal, insects prefer to eat the largest seeds they can physically consume to maximize their foraging efficiency (Lundgren 2009). Omnivorous insects have also adapted features within their intestinal tract to destroy the hard portions of the seed that could damage the midgut; the adaptations these insects have developed include sharp raduli covering the anterior portion of the proventriculus, thought to better destroy the hard seeds and protect the mid- and hindgut (Forsythe 1982). Enzymes play a key role for the digestion of seeds by many insects. Some insects regurgitate fluids which contain enzymes that break down the seed, allowing the insect to consume the emulsified liquid (Woodring et al. 2007). Many cellulose-feeding Coleoptera digest much of the material in the midgut by using specialized enzymes and elevated pH (Terra 1990). Symbiotic bacteria and fungi are often a source of the digestive enzymes found in the intestinal tract of insects.

Harpalus pensylvanicus (DeGeer) (Coleoptera: Carabidae) is an omnivorous carabid commonly found in cropland throughout North America, benefitting agricultural producers by consuming insect pests and weed seeds (Eskelson et al. 2011; Ward et al. 2011). This beneficial insect harbors a relatively simple gut community of bacterial populations (Lundgren et al. 2007; Lehman et al. 2009; Lundgren & Lehman 2010). The bacterial populations residing within the gut of H. pensylvanicus are considered facultative or secondary endosymbionts, as opposed to obligate or primary symbionts. Within that endosymbiont community, the bacterium Enterococcus faecalis (Lactobacillales: Enterococcaceae) has been isolated (Lundgren & Lehman 2010). Enterococcus faecalis is a widely distributed bacterium found in a variety of environments including animals, humans, and food (Klein 2003; Getachew et al. 2013). Enterococcus faecalis is commonly associated with the gastrointestinal tract of their host organism, and has been observed as being both a pathogenic and beneficial symbiont (Sava et al. 2010). Within H. pensylvanicus, E. faecalis is hypothesized to be responsible for increased seed consumption by the beneficial beetle (Lundgren & Lehman 2010). We used a combination of antibiotic treatment and inoculation with E. faecalis to directly test if the endosymbiont E. faecalis is responsible for the increased seed consumption by H. pensylvanicus.

Materials and Methods

Enterococcus faecalis

Intestinal tracts of 10 field-collected H. pensylvanicus were aseptically dissected, homogenized with a sterile mortar and pestle, suspended in phosphate buffer, and spread onto m-Enterococcus selective growth medium (Difco m-Entercoccus Agar, Becton, Dickinson and Company, Sparks, Maryland). Agar plates were incubated at 35 °C for 72 h. Morphologically-distinct colonies were selected and restreaked until purified. DNA was extracted from isolated colonies using DNeasy Blood and Tissue kit (DNeasy Blood and Tissue Kit, Catalog No. 69506, Qiagen Sciences, Germantown, Maryland) per manufacturer's instructions for gram positive bacteria. DNA extractions were screened on 0.7% agarose gel (100V, 25 min). The 16S rRNA genes from these isolates were PCRamplified using the eubacterial primers 8F (5′ — AGAGTTTGATCCTGGCTCAG — 3′) and 1492R (5′ — GGTTACCTTGTTACGACYT — 3′) with the reaction mixture and PCR conditions described in Lundgren and Lehman (2010). PCR products were screened on 1.2% agarose gel (75 V, 45 min) with positive (E. coli DNA) and negative (reagents only) controls and then purified using Wizard PCR Preps DNA Purification System (Promega). The PCR products were sequenced at the Iowa State DNA Sequencing Facility using the eubacterial primers 8F, 530F (5′ — GTGCCAGCMGCCGCGG — 3′), and 1100F (5′ — GCAACGAGCGCAACCC — 3′). Edited, assembled, aligned, and chimera-checked 16S rRNA sequences were compared to entries in GenBank database using BLASTn to determine the closest match. Two distinct phylotypes resulted from these isolations, a strain (Egut10) that closely matched (>99.5% similarity) Lactococcus garvieae, and a strain (Egut6) that closely matched (>99.5% similarity) members of the Enterococcus faecalis group as described by Byappanahalli et al. (2012). The E. faecalis isolate (Egut6, GeneBank Accession # KF178438) was used for inoculations of H. pensylvanicus in the feeding assay.

Fig. 1.

Diagram outlining the treatment structure of the feeding assay.

Results

Effects of E. faecalis Treatment on Seed Consumption

The difference in the seed weight consumed was marginally significant between beetles fed E. faecalis or not (antibiotic: F_{1, 147} = 7.72, P = 0.01; E. faecalis: F_{1, 147} = 3.18, P = 0.08; antibiotic × E. faecalis: F_{1, 147} = 3.04, P = 0.08) (Fig. 2). The marginally significant interaction term was caused by the different responses observed in the treatments that received antibiotics versus no-antibiotics. Within the antibiotic-fed treatments, the sub-treatment fed E. faecalis consumed a greater weight of seeds (0.41 ± 0.05 g) than the treatment that received no E. faecalis (0.26 ± 0.04 g). There was no difference between the treatments receiving E. faecalis or not when antibiotics were not administered to the beetles. The E. faecalis fed treatments had a lower E.C.I. (2.38 ± 0.15) than the treatments that received no E. faecalis (2.82 ± 0.15) (antibiotic: F_{1, 147} = 2.87, P = 0.09; E. faecalis: F_{1, 147} = 4.41, P = 0.04; antibiotic × E. faecalis: F_{1, 147} = 0.83, P = 0.36) (Fig. 3A). The antibiotic treatments also had a lower E.C.I. (2.42 ± 0.15) than the treatments fed no antibiotics (2.77 ± 0.15), but this difference was only marginally signify cant (Fig. 3A). The E. faecalis fed treatments had a lower E.C.D. (2.39 ± 0.15) than the treatments that received no E. faecalis (2.85 ± 0.16) (antibiotic: F_{1, 147} = 3.09, P = 0.08; E. faecalis: F_{1, 147} = 4.59, P = 0.03; antibiotic × E. faecalis: F_{1, 147} = 0.68, P = 0.41) (Fig. 3B). Again, the antibiotic treatments had a lower E.C.D. (2.43 ± 0.15) than the treatments fed no antibiotics (2.81 ± 0.16), but this difference was only marginally significant (Fig. 3B). All treatments had similar A.D.s of seeds (antibiotic: F_{1, 147} = 1.50, P = 0.22; E. faecalis: F_{1, 147} = 1.14, P = 0.29; antibiotic × E. faecalis: F_{1, 147} = 0.67, P = 0.41) and consumed similar numbers of seeds (not weight of seeds) (antibiotic: F_{1, 33} = 0.22, P = 0.65; E. faecalis: F_{1, 33} = 1.24, P = 0.27; antibiotic × E. faecalis: F_{1, 33} = 0.17, P = 0.68). Beetle wet weights (mean ± SEM) were 141 ± 4, 146 ± 4, 143 ± 4 and 139 ± 5 mg for the antibiotic +, E. faecalis +; antibiotic +, E. faecalis -; antibiotic -, E. faecalis +; and antibiotic -, E. faecalis - treatments, respectively. Feces dry weights were 0.41 ± 0.07, 0.53 ± 0.08, 0.52 ± 0.07, and 0.64 ± 0.08 mg for the antibiotic +, E. faecalis +; antibiotic +, E. faecalis -; antibiotic -, E. faecalis +; and antibiotic -, E. faecalis - treatments, respectively.

Fig. 2.

The effects of Enterococcus faecalis on seed weight consumed per beetle by Harpalus pensylvanicus. The asterisk denotes significant differences within these antibiotic or no antibiotic treatments (á = 0.05). Antibiotic +, E. faecalis + n = 58; Antibiotic +, E. faecalis - n = 58; Antibiotic -, E. faecalis + n = 58; and Antibiotic -, E. faecalis - n = 57.

Recovery of E. faecalis from Treated Beetles

The different treatments had an effect on E. faecalis recovered on the selective media. The 2 bacterial DNA sequences from the antibiotic +, E. faecalis + treatment were identified as E. faecalis. No DNA sequences were obtained from the antibiotic +, E. faecalis - treatment. The antibiotic -, E. faecalis + had 2 bacterial colonies identified as E. faecalis, 2 colonies most closely matching Enterococcus sp., and 1 colony most closely matching Stenotrophomonas sp. Lastly, the antibiotic -, E. faecalis - treatment contained 1 bacterial colony that matched E. faecalis and 1 bacterial colony that matched an Enterococcus sp. As can be seen from the DNA sequencing results, it appears as though our antibiotic and E. faecalis treatments produced the desired effects. The antibiotics reduced gut microbiota as the antibiotic +, E. faecalis - treatment produced no DNA sequences, and the antibiotic +, E. faecalis + treatment only produced E. faecalis which was expected. Also, the antibiotic -, E. faecalis + treatment contained several bacterial species along with E. faecalis which was the intended result. Finally the antibiotic -, E. faecalis - treatment provided an unaltered gut community to study.

Fig. 3.

The effects of Enterococcus faecalis and antibiotic treatment on A. efficiency of conversion of ingested material (E.C.I.) to biomass and B. efficiency of converted digested material (E.C.D.) to biomass per beetle of Harpalus pensylvanicus. Antibiotic +, E. faecalis + n = 58; Antibiotic +, E. faecalis - n = 58; Antibiotic -, E. faecalis + n = 58; and Antibiotic -, E. faecalis - n = 57.

Discussion

Our research supports the hypothesis that facultative symbioses between gut bacteria and insects can have important implications for insect diet consumption rates, but that these relation- ships may be more complicated than was previously proposed. Treating beetles with antibiotics (i.e., antibiotic +) followed by the facultative symbiont E. faecalis increased the weight of seeds consumed and decreased the E.C.I. and E.C.D. In contrast, beetles that had their gut endosymbiont community intact (i.e., antibiotic -) when E. faecalis was administered did not consume additional seeds. Lack of increased seed consumption (by weight) by antibiotic -, E. faecalis + beetles could have been caused by several reasons, such as suppression of E. faecalis colony establishment by the existing gut microbiota, endosymbiont competition, or niche overlap within the gut bacteria. Another result, which was unexpected, was that administering solely antibiotics (antibiotic +, E. faecalis - treated beetles) did not reduce seed consumption relative to the treatments receiving no antibiotics (i.e., antibiotic -, E. faecalis -), a frequently observed result in this study system (Lundgren & Lehman 2010). One possible explanation for this discrepancy in the current work is that pathogens or parasites in the antibioticfree treatment may have lowered the seed consumption levels of the host; antiobiotics may have cured the pathogens from the guts, but also eliminated the beneficial microbes that encourage seed consumption, thus leading to equivalent seed consumption rates in these 2 treatments. Additional research that explores the complexities of these interactions under different scenarios may help to shed light on why we did not observe reduced seed consumption in antibiotic-treated beetles as expected.

The E. faecalis treatment with suppressed microbiota (antibiotic +, E. faecalis +) in the guts was correlated with an increase in weight of seed consumption and decreased E.C.I. and E.C.D. by H. pensylvanicus. E.C.I is described as the ability of an insect to utilize ingested food for growth, and E.C.D. is the efficiency that digested food is converted to body substance (Waldbauer 1968). A decrease in E.C.D. means that a larger proportion of digested food is being metabolized for energy (Waldbauer 1968). So, the decrease in E.C.I. and E.C.D. of E. faecalis fed beetles is simply due to the fact that the beetles are devoting less energy to support growth and more energy to support activity and maintaining physiological function (Waldbauer 1968). With E.C.I. and E.C.D. being tightly correlated with each other, the question then becomes what caused the weight of seed consumption to increase? The specific mechanism underlying increased weight of seed consumption is unclear at this point, but a potential answer is that E. faecalis complemented the digestive capacity of H. pensylvanicus. Microbial symbionts provide a variety of functions for the digestion of their host's diet. These functions include the provision of many essential nutrients such as nitrogen, amino acids, vitamins, and sterols (Douglas 1998; Nasir & Noda 2003; Douglas 2009; Snyder et al. 2010). Symbionts also provide protection from pathogens, provision of antibiotics, and digestive enzymes (Currie et al. 1999; Lundgren 2009; Vorburger et al. 2010). Perhaps E. faecalis complemented the digestive capacity of H. pensylvanicus by contributing enzymes that break down the unique nutritional components of seeds. Cellulose is a common component of seeds, and there are many gut endosymbionts which produce digestive enzymes that break down cellulose (Kukor & Martin 1983; Sinsabaugh et al. 1985; Kukor et al. 1988). The endosymbionts contributing to cellulose breakdown within the intestinal tract often originate within certain phylogenetic clades. The common cellulase-producing endosymbionts found in these organisms often fall in the classes of Clostridia and Bacilli (Hongoh 2010; Huang et al. 2010; Zhu et al. 2011). Enterococcus faecalis belongs to the class Bacilli, and it is feasible and testable that this symbiont could contribute to seed digestion by producing cellulolytic enzymes. Enterococcus faecalis has been found within the gut microbial community of insects such as gypsy moth larvae, green stink bugs, termites, and silkworms (Lu et al. 1994; Bauer et al. 2000; Hirose et al. 2006; Allen et al. 2009). These insects primarily consume leaves or other plant material which are high in cellulose. According to Broderick et al. (2004), E. faecalis is an essential endosymbiont to gypsy moths (Lymantria dispar [L.]; Lepidoptera: Erebidae) which primarily consume tree leaves. This is not to say that cellulolytic enzymes are the only explanation for the increased weight of seed consumption by H. pensylvanicus, as there are numerous other services that symbionts provide which may contribute to increased seed consumption such as improving food utilization or food detoxification (Douglas 2009). However, based on the results of previous studies where E. faecalis was closely associated with herbivorous insects and the fact that E. faecalis is a member of a taxa known for providing enzymes makes the hypothesis of cellulolytic enzymes production by E. faecalis one potential theory worth further investigation.

Interactions with the existing microbiota may affect the ability of E. faecalis to increase seed consumption by H. pensylvanicus. In treatments where E. faecalis was present along with the endemic gut bacteria (antibiotic -, E. faecalis +), weight of seed consumption did not increase over the control treatment that did not receive E. faecalis (antibiotic -, E. faecalis -) (Fig. 2); this is in contrast to the treatment with their endemic gut bacteria reduced that received E. faecalis (antibiotic +, E. faecalis + vs antibiotic +, E. faecalis -) (Fig. 2). In the antibiotic -, E. faecalis + treatment, E. faecalis may have not been able to establish or compete well with the existing microbiota, as microbes deploy various mechanisms that allow them to overcome competitors in their environment (Refardt 2011; Rendueles & Ghigo 2012). Sometimes a simple mechanism such as large colony size gives a microbe a competitive edge (Li & Li 2012), and other times a more sophisticated mechanism such as bacteriocins is employed (Majeed et al. 2011). The naturally occurring gut microbiota in H. pensylvanicus is relatively simple ranging from 2-5 different symbiont species per beetle (Lundgren et al. 2007). The endosymbionts found in H. pensylvanicus were affiliated with Alphaproteobacteria, Gammaproteobacteria, Bacilli, and Mollicutes (Lundgren et al. 2007; Lundgren & Lehman 2010). Using the selective growth medium, we isolated a strain most similar to Enterococcus sp. in addition to E. faecalis from the digestive tracts of H. pensylvanicus. These species are both considered to be lactic acid bacteria that commonly ferment carbohydrates and are tolerant of an acidic microenvironment. Many Enterococcus and lactic acid producing bacteria produce bacteriocins or antimicrobials that are antagonistic against other bacteria including other Enterococcus species or lactic acid bacteria (Ott et al. 2001; Poeta et al. 2006; Theppangna et al. 2007; Brandao et al. 2010). For example Enterococcus faecium CE5-1 produces bacteriocins that have inhibitory activity against E. faecalis (Saelim et al. 2012). In fact many microbial species produce bacteriocins that inhibit closely related species as part of a survival mechanism to eliminate the competition (Cleveland et al. 2001). Thus, it is plausible to think that E. faecalis was not able to establish well in the treatments with an established bacterial community.

Before drawing sweeping conclusions on the importance of this symbiosis for the dietary breadth or niche separation among omnivorous insects, it is important to study the symbiotic interactions revealed here under more natural settings. Under natural conditions and in laboratory choice tests, H. pensylvanicus consumes numerous other foods, including pollen, fungi, and insect prey (Kirk 1973; Best & Beegle 1977; Larochelle 1990; Riddick & Mills 1994; Ahmad et al. 2006). Each of these foods is associated with unique defensive and nutritional characteristics. Also, the bacterial community within H. pensylvanicus and other insect guts is dynamic, and thus environmental changes could influence the strength of the E. faecalis - H. pensylvanicus symbiosis, and the predominance of bacterial taxa within insect guts. The results of this experiment indicate that the benefit of the symbiotic relationship between E. faecalis and H. pensylvanicus is dependent on the elimination of the natural occurring gut microbiota first. It is unpractical to administer antibiotics and then E. faecalis under field conditions, thus studying the factors that contribute to strengthening the symbiotic relationship between H. pensylvanicus and E. faecalis or other beneficial gut symbionts is an important next step. For example abiotic factors affect the bacterial diversity within an environment (Roesch et al. 2007; Fierer & Lennon 2011; Andrew et al. 2012; Wang et al. 2012). Bacterial-animal symbioses have important implications for the evolution of dietary specializations, and the facultative yet functional relationship described in our research may help better understand the continuum in this interaction between trophic behavior and the fidelity of a nutritional symbiosis.