Translator Disclaimer
1 June 2014 Composition and Expression of Heat Shock Proteins in an Invasive Pest, The Rice Water Weevil (Coleoptera: Curculionidae)
Author Affiliations +
Abstract

For poikilothermic groups such as insects, the capacity to adapt to different temperature regimes is particularly important for survival. To investigate the possible role of heat shock proteins (Hsps) in the invasive pest, the rice water weevil (Lissorhoptrus oryzophilus Kuschel, Coleoptera: Curculionidae), we first analyzed the composition and expression profile of Hsp families under sub-lethal temperatures of 0 °C and 43 °C, using the quantitative realtime polymerase chain reaction. Eight genes coding Hsp90, Hsp70, and small Hsps were upregulated under heat stress, while only 1 Hsp70 gene and 1 Hsp90 gene were up-regulated under cold stress. Results indicate that Hsps from all families except Hsp60 are responsible for the capacity of L. oryzophilus to tolerate temperature stress, although more genes were up-regulated, and more rapidly, under heat stress than under cold stress. Secondly Hsp expression patterns in diapausing and non-diapausing female adults were investigated. The results showed that rice water weevils in diapause up-regulated no Hsp gene but they downregulated 4 small Hsps, 2 Hsp90, 1 Hsp70 and 1 Hsp60 genes.

Many environmental factors affect the distribution of species in nature such as temperature and humidity (Gibbs et al. 2003), chemicals and heavy metals (Macnair 1997). Thermal environments often vary spatially and temporally across the geographic range of a species, and such variation can be an important selection force leading to genetic divergence among local populations (Angilletta 2009). When individuals in a population are exposed to stressful conditions, there are 3 possible outcomes, i.e., they avoid the stress, they adapt to the stress, or they are killed (Hoffmann et al. 1991). There is, however, a particular set of proteins, named heat stress proteins (Hsps), that are preferentially expressed under stress (Peter et al. 2002). These are highly-conserved molecules that are categorized into several subgroups according to size, structure and function (Lindquist et al. 1988; Boorstein et al. 1994; Richter et al. 2010). Expression of Hsps is increased when the cells are exposed to elevated temperatures, and they are induced in cells exposed to sub-lethal heat shock (Kiang & Tsokos 1998). The heat shock response was first discovered by Ritossa (1962) in Drosophila melanogaster Meigen (Drosophilidae). The induction of Hsps occurs under circumstances relevant to the environment of the species, such that in arctic fish Hsps are induced around 5 °C and in thermophilic bacteria around 100 °C (Parsell et al. 1993). Hsp families are known to be important in the biology of insects. For example, small heat shock proteins and Hsp70 are related to thermo-tolerance in the silkworm (Bombyx mori [L.]; Bombycidae) (Moghaddam et al. 2008).

In addition to their role in thermal tolerance, Hsps can be induced by a variety of other stimuli, and they play broader roles. Members of the Hsp70 family in particular are constitutively expressed in cells under normal conditions and function as molecular chaperones, to keep other proteins from forming inappropriate aggregations (Mbaye 2010). As well as being induced by a variety of stresses, Hsp expression can vary with the physiological state of the organism and developmental stage (Feder et al. 1999). For example, Hsp23 and Hsp70 of the flesh fly, Sarcophaga crassipalpis Macquart (Sarcophagidae), are highly up-regulated during diapause (Yocum et al. 1998; Rinehart et al. 2000). Similarly, one of the 2 copies of Hsp70 gene in diapausing adults of Colorado potato beetle, Leptinotarsa decemlineata Say (Chrysomelidae), is up-regulated (Yocum 2001). In the gypsy moth, Lymantria dispar (L.) (Erebidae), Hsp70 is not expressed at the initiation of diapause, but only after exposure to low temperature (Yocum et al. 1991). Notwithstanding the similarities in the role of Hsps in the foregoing examples, there is no fixed expression pattern of Hsp genes among different species. Accordingly, this study was aimed to elucidate the expression pattern of Hsps in the rice water weevil, Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae), an invasive pest species that has not been the subject of earlier studies of its capacity to tolerate environmental stresses.

The rice water weevil originates from the Mississippi River Valley of the USA (Lange & Grigarick 1959). Parthenogenetic females were found in rice in California in 1959. This species has subsequently come to be considered as an important pest of this crop (Godfrey & Espino 2009). Lissorhoptrus oryzophilus has invaded parts of eastern Asia since the 1970s (Way 1990; Kim et al. 1996; Kobayashi et al. 1997; Zhai et al. 1999; Stout et al. 2002; Zhu et al. 2005). In China, the world's largest rice producer, this pest was first detected in Hebei Province in 1988 and is now found over an extensive area from Jilin Province (N 41° – N 46°) to Yunnan Province (N 23° – N 25°) where the climate ranges from temperate to tropical. Lissorhoptrus oryzophilus is able to overwinter in the temperate parts of its range as well as to tolerate seasonally high temperatures in summer; thus it possesses effective mechanisms for coping with thermal stress.

Diapause, the arrest of development or normal activity during adverse environmental conditions (Chapman 1998), is suggested as the means for over-summering and over-wintering by the weevil in its large geographical range (Jiang et al. 2004; Zhu et al. 2005). However, whether the Hsps play a role in diapause remains unclear.

To investigate the relationship between the expression pattern of Hsp genes and temperature stress, firstly, we searched for all Hsp genes in the L. oryzophilus transcriptome database. Secondly, we exposed insects to the sub-lethal low and high temperatures of 0 °C and 43 °C for 0.5 - 3 h to identify the expression patterns of Hsps under thermal stress. Thirdly, we compared the expression of Hsps between diapausing and nondiapausing L. oryzophilus female adults.

Materials and Methods

Insect Collection and Rearing

Rice stubble with attached in roots infested with L. oryzophilus cocoons was collected from rice fields in Xinchengfan village, Leping County, Jiangxi Province, China in July 2012 and kept in plastic containers within a cage covered with fine nylon mesh in an insectary. Emerging adults were collected daily and transferred to 100 mL plastic bottles under 16:8 h L:D, 25 ± 1 °C and 70% RH as in Yang et al. (2010). Adults were fed with 20-day-old rice seedlings (cv. ‘Xiushui 110', Japonica).

Diapausing L. oryzophilus adults were collected from the surface soil of a hill nearby rice fields in Yueqing county, Zhejiang Province, China on 2 Nov 2012 and kept in plastic containers within a cage covered with fine nylon mesh. Live individuals were transferred to -80 °C immediately after their arrival at the laboratory. These adults were determined as diapausing weevils according to Shang (2003). The nondiapausing weevils were collected in 5 July 2012 and frozen at the -80 °C. According to the yearly population dynamics of the weevils indicated in Zhai et al. (1997), this batch of weevils probably were recently emerged and their age probably was 2–3 weeks, and they had not yet entered to diapause.

cDNA Library Preparation and Illumina Sequencing

Total RNA of L. oryzophilus adults were extracted by using TRIzol reagent (Invitrogen, California, USA) according to the manufacturer's protocol. According to the Illumina manufacturer's instructions, poly(A)+ RNA was purified from 20 ug of total RNA using ologo(dT) magnetic beads and fragmented into short sequences in the presence of divalent cations at 94 °C for 5 min. The cleaved poly(A)+ RNA was transcribed, and second-strand cDNA was synthesized. After the end-repair and ligation of adaptors, the products were amplified by PCR and purified using the QIAquick PCR Purification Kit to create a cDNA library.

The cDNA library was sequenced on the Illumina sequencing platform (GAII). The raw reads were generated using Solexa GA pipeline 1.6. After removal of low quality reads, processed reads with an identity value of 95% and a coverage length of 100 bp were assembled using SOAP de novo software and clustered using TGI Clustering tools. Generated unigenes larger than 350 bp were analyzed by searching the GenBank database with the BLASTX algorithm (data unpublished).

Searching the Lissorhoptrus oryzophilus Transcriptome Database for Hsp Sequences

Hsp genes were identified by searching the sequences in this transcriptome database with keywords ‘heat shock protein' or ‘Hsp'. Further searches of Hsp cDNAs were conducted using BLASTX to compare the sequence against the non-redundant database at NCBI ( www.ncbi.nlm.nhi.gov/). Also, known insect hsp genes in GenBank were used to search for similar genes in the transcriptome (TBLASTN).

Alignment of Multiple Sequences of Deduced Amino Acids

Comparisons of deduced amino acid sequences of Hsp60, Hsp70 and Hsp90 of L. oryzophilus and Tribolium castaneum were conducted at  www.ebi.ac.uk/Tools/msa/clustalw2/ and motifs were searched at  www.genome.jp/tools/motif/.

Temperature Exposure

For exposure to different temperatures, adults were placed as groups of 30 into 6-cm diam Petri dishes. Each sample was run in triplicate. The low temperature, 0 °C, was obtained in a refrigerator (Siemens, Germany) and the 43 °C environment was obtained in a climate chamber (Saifu Co., Ningbo, China). Weevils were exposed for 0.5, 1, 2 and 3 h, after which, all, except 1 weevil from the 3 h high temperature treatment, were live. Three live individuals were transferred to -80 °C from each run immediately after treatment. The heat-treatment temperature was selected according to the previous results in which a constant 40 °C resulted in 0% hatchability (Raksarart & Tugwell 1975), and the 50% lethal time of adult females under constant 38 °C was 25 days (Shang 2003). The real daily temperature fluctuation in the rice field in Asian subtropics showed that 2–3 h of just under 40 °C and 0.5-1 h of > 43 °C occur on some summer days (Wei & Chen 2009;  http://lishi.tianqi.com/xinchang/201308.html) and these short intervals of extreme temperatures might be a major mortality factor (Shih & Cheng 1993).

RNA Extraction and cDNA Synthesis

Total RNA of 3 individuals for each treatment was extracted by using TRIzol reagent (Invitrogen, California, USA). Single-stranded cDNA was synthesized from 1 μg RNA in a 50 uL reaction system with ReverTraAce qPCR RT Master Mix with gDNA Remover (Toyobo, Japan) according to manufacturer instructions.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

To measure expression of Hsp genes, qRTPCR was used with the primer pair detailed in Table 1. A pre-run test was carried out to confirm the constant expression of the actin and tubulin genes in each sample. Tubulin was used as a normalization gene with the forward primer 5′- GCCTGCTGGGAACTGTATTGTT -3′ and the reverse primer 5′- CGCCGAAAAACGTGTTAAAAC -3′ with an expected product size of 100 bp. Amplifications were performed using Thunderbird SYBR qPCR Mix (Toyobo, Japan) and 5 pmol of each primer. To ensure the validity of the data, the expression of each gene was tested in triplicate in each of 3 biologically independent experiments. Each RNA sample in each replicate was prepared from 3 individuals. The cycling conditions were: (1) 95 °C, 30 s; (2) 95 °C, 5 s; (3) 60 °C, 30 s; (4) go to 2, 40 cycles. A CFX96 machine (Bio-Rad, USA) and the accompanying software were used for qRT-PCR data normalization and quantification.

After the qRT-PCR assay, results were normalized to the expression level of the tubulin reference gene. The relative quantitative method (ΔΔCt) was used to evaluate the expression levels (Lival et al 2001). Arbitrary cut-offs of 2.0 × and 0.5 × relative expression ratios compared to that of the reference gene were set as thresholds of up-regulation and down-regulation, respectively.

Table 1.

Primers for qrt-pcr of heat shock proteins of the rice water weevil, Lissorhoptrus oryzophilus.

t01_611.gif

Results

In order to facilitate clarity, the deduced alignments of amino acids of heat shock protein families of the rice water weevil are shown with color coding of the various amino acids in Suppl. Fig. 1, which can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse. Also a colored version of each of several other figures are found in the supplementary material.

Analysis of Hsp Genes from the Transcriptome

Twenty-one cDNA sequences were obtained from the transcriptomes, including 12 small Hsps, 1 Hsp60 gene, 5 Hsp70 genes and 3 Hsp90 genes (Table 2). Hsp60s, Hsp70s and Hsp90s were more conserved than small Hsps.

Multiple Sequence Alignment

Small Hsps showed relatively low identities, the most divergent of protein sequences were identical at 36% (Table 2). Hsp60, Hsp70 and Hsp90 family members were more conserved. The most divergent of these protein sequences were 83%, 86% and 62% identical, respectively (Table 2). Deduced amino acid sequences of Hsp60, Hsp70 and Hsp90 of L. oryzophilus were compared with corresponding genes of Tribolium castaneum (Herbst) (Tenebrionidae) (Suppl. Fig. 1).

Fig. 1.

Relative expression of L. oryzophilus small Hsps under cold stress (0 ˚C) compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

f01_611.jpg

Table 2.

Lissorhoptrus oryzophilus heat shock protein (Lohsps) genes and their similarities with those of other species.

t02_611.gif

Response to Cold Stress

Hsp genes which determine to small Hsps (LoHsp23, LoHsp21i, LoHsp21f, LoHsp21c), Hsp60 (LoHsp60) and Hsp90 (LoHsp90a) were down-regulated when the insects were exposed to the low temperature for 3 h. One Hsp90 (LoHsp90b) and one Hsp70 (LoHsp70e) were upregulated after exposure to 0 °C for 3 h (Figs. 1 and 2).

Response to Heat Stress

Under heat stress, more Hsps were up-regulated including Hsp70, Hsp90 and the small Hsp families (Figs. 3 and 4), than under cold stress (Figs. 1 and 2). Four small Hsp genes (LoHsp21h, LoHsp20.6, LoHsp21b, LoHsp21e) were up-regulated when exposed for 0.5 h, and up-regulation reached its peak at 1 h, then declined though remaining higher than in the control except for LoHsp21e. These 4 small Hsps showed a similar expression pattern (Fig. 3). One Hsp70 gene (LoHsp70d) was especially strongly up-regulated starting from 0.5 h, reached a peak of expression at 2 h, then declined but was still up-regulated compared to the control. In total, 2 Hsp70 genes (LoHsp70d and LoHsp70e) and 2 Hsp90 genes (LoHsp90b and LoHsp90c) were up-regulated after heat treatment (Fig. 4).

The weevils underwent a series of physiological changes during the diapause stage. No Hsp gene was up-regulated in the diapausing adult females, while 4 small Hsps (LoHsp20.6, LoHsp21d, LoHsp21i, LoHsp23), 1 Hsp60 (LoHsp60), 1 Hsp70 (LoHsp70a) and 2 Hsp90s (LoHsp90a, LoHsp90b) were down-regulated (Fig. 5).

Fig. 2.

Relative expression of L. oryzophilus Hsp60, Hsp70 and Hsp90 genes under cold stress compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

f02_611.jpg

Fig. 3.

Relative expression of L. oryzophilus small Hsps under heat stress compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

f03_611.jpg

Fig. 4.

Relative expressions of L. oryzophilus Hsp60, Hsp70 and Hsp90 genes under heat stress compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

f04_611.jpg

Discussion

In all organisms examined, from Archeobacteria to humans, temperature elevation above the normal physiological temperature leads to a heat shock response, which consists of a profound alteration of gene expression (Morimoto et al. 1994). In the present study, the cDNA sequences of 12 small Hsp, 1 Hsp60, 5 Hsp70 and 3 Hsp90 genes were determined. These Hsp genes are the first determined in the largest family (Curculionidae) of the largest insect order (Coleoptera). Of specific importance are the 8 genes belonging to the Hsp90s, Hsp70s, and small Hsp families that were up-regulated under heat stress and the 1 Hsp70 and 1 Hsp90 gene that were up-regulated under cold stress. Results indicate that Hsp70s, Hsp90s and small Hsps were responsible for adapting to the temperature stress of L. oryzophilus. Hsp expression under thermal stress provided an interesting contrast to the typical stress response in which all Hsps are up-regulated. The experimental system was specifically designed to focus on heat and cold shock response to short stressful conditions, which demonstrated that L. oryzophilus has the capacity to adapt to temperature stress under extreme unpredictable environmental events, either during their invasion process by non-intentional human transportation or in overwintering post-arrival in new habitats. Our results showed that certain Hsp70, Hsp90, and small Hsp genes were strongly up-regulated under heat stress and this up-regulation can extend over several hours. Under cold stress, in contrast, only 1 Hsp70 and 1 Hsp90 genes were slightly up-regulated. The expression of 2 small Hsps (LoHsp12.2 and LoHsp21g) was not affected by temperature, suggesting that they are involved in other, non-thermal tolerance roles in the insect's biology. For example, Gu et al. (2012) found that Hsp70 and small Hsps are involved in midgut metamorphosis in the common cutworm, Spodoptera litura (F.) (Noctuidae). Small heat shock proteins also help to protect cells from apoptosis, stabilize the cytoskeleton and contribute to proteostasis as housekeeping proteins (Morrow & Tanguay 2012).

Hsp70 proteins have been discovered in a wide range of species and their structure and function is highly conserved (Schlesinger 1990). Up-regulation of Hsp70 mRNA levels in response to low temperature has been reported in insects from various orders (Sinclair et al. 2007; Huang et al. 2007; Yocum 2001; Wang et al. 2008; Elekonich 2009; Yang et al. 2012). In the present study, 1 of the 5 Hsp70 genes was up-regulated in L. oryzophilus exposed to low temperature for 3 h. In contrast, 2 Hsp70 genes and 2 Hsp90 genes were up-regulated in L. oryzophilus exposed to high temperature. More small Hsp genes were involved in the adaptation to the heat stress, and those 2 Hsp70s and Hsp90s were continuously up-regulated across the stress. Yang et al. (2012) showed that Hsp70s were more critical to coping with heat stress than cold shock. Hsp70 responds dramatically to either heat or cold shock, which can induce a thousand-fold response (Velazquez et al. 1983; Huang & Kang 2007).

Fig. 5.

Relative expression of Hsp genes in diapausing adult females compared to non-diapausing controls.

f05_611.jpg

The involvement of Hsp in insect diapause has been studied in several species. In the flesh fly, S. crassipalpis, most but not all Hsps are up-regulated during diapause. Although many reports suggest that Hsps are associated with diapauses (Rinehart et al. 2000, 2007; Yocum et al. 1998), this is not the case in all studied insects. For example, Hsps do not appear to be up-regulated in Drosophila triauraria Bock & Wheeler during diapause (Goto et al. 1998, 2004), but were in larval diapause of Lucilia sericata Meigen (Calliphoridae) (Tachibana 2005) and adult diapause of Culex pipiens L. (Culicidae) (Rinehart et al. 2006). Expression patterns of heat shock protein genes are highly variable among species that undergo diapause. The present study showed that no Hsp gene was up-regulated but 4 small Hsps, 1 Hsp60, 1 Hsp70 and 2 Hsp90 genes were down-regulated during the diapause of L. oryzophilus. Rinehart & Denlinger (2000) reported 1 Hsp90 is downregulated during pupal diapause in the flesh fly, S. crassipalpis, but remained responsive to thermal stress, indicating that even a down-regulated protein can be involved in thermal stress.

There is no fixed pattern for the expression of Hsps. Further, heat shock is not the only environmental stress that can induce the expression of Hsps. Other factors such as heavy metals (Levinson et al. 1980); protein kinase C timulators (Ding et al. 1996); Ca2+ increasing agents (Ding et al. 1998) also can induce Hsp expression. Different proteins in the same family can show different expression patterns under the same treatment. In the present study LoHSP70e, LoHSP70b, LoHSP70c and LoHSP70d belong to Hsp70 family, but showed varied expression ratios after cold and heat shocks. When the weevils were exposed to 43 °C, the expression ratios for these 4 Hsp70 genes varied strongly. LoHSP70d and LoHSP70e were strongly up-regulated while the other 2 Hsp70 genes showed no difference between treatment and no-treatment. The precise roles of different Hsps are still not fully understood. Further study should consider this group of proteins in coping with thermal stress and possibly other environmental challenges encountered by invading species.

Acknowledgments

This work was financially supported by the 973 Program (2009CB119200) of the Ministry of Science and Technology of China and the Key Project of the Department of Science and Technology of Guizhou Province (Qian Ke He NY [2010] 3079), China. Thanks to Mr. Zhi-Qing Dong for rice and insect rearing.

References Cited

  1. M. J. Angilletta 2009. Thermal adaptation: a theoretical and empirical synthesis. London: Oxford University Press. Google Scholar

  2. W. R. Boorstein , T. Ziegelhoffer , and E. A. Craig 1994. Molecular evolution of the Hsp70 multigene family. J. Mol. Evol. 38: 1–17. Google Scholar

  3. R. F. Chapman , S. J. Gimpson , and A. E. Douglas 1998. The Insects, Structure and Function, 4th Edition. London: Cambridge University Press. 403 pp. Google Scholar

  4. X. Z. Ding , R. C. Smallridge , R. J. Galloway , and J. G. Kiang 1996. Increases in HSF1 translocation and synthesis in human epidermoid A-431 cells, role of protein kinase C and [Ca2+]. J. Invest. Dermatol. 44: 144–153. Google Scholar

  5. X. Z. Ding , G. C. Tsokos , and J. G. Kiang 1998. Overexpression of HSP-70 inhibits the phosphorylation of HSF1 by activating protein phosphatase and inhibiting protein kinase C activity. FASEB 12: 451–459. Google Scholar

  6. M. M. Elekonich 2009. Extreme thermotolerance and behavioral induction of 70-kDa heat shock proteins and their encoding genes in honey bees. Cell Stress Chaperones 14: 219–226. Google Scholar

  7. M. E. Feder , and G. E. Hofmann 1999. Heat-shock proteins, molecular chaperones, and the stress response, evolutionary and ecological physiology. Annu. Rev. Physiol. 61: 243–282. Google Scholar

  8. A. G. Gibbs , M. C. Perkins , and T. A. Markow 2003. No place to hide, microclimates of Sonoran Desert Drosophila. J. Therm. Biol. 28: 353–362. Google Scholar

  9. L. Godfrey , and L. Espino 2009. Rice Invertebrates, pp. 34–65 In L. Godfrey [ed.], University of California IPM Pest Management Guidelines. California: UC ANR, Publ. Google Scholar

  10. S. G. Goto , and M. T. Kimura 2004. Heat-shockresponsive genes are not involved in the adult diapause of Drosophila triauraria. Gene 326: 117–122. Google Scholar

  11. S. G. Goto , K. M Yoshida , and M. T. Kimura 1998. Accumulation of Hsp70 mRNA under environmental stresses in diapausing and nondiapausing adults of Drosophila triauraria. J. Insect Physiol. 44: 1009– 1015. Google Scholar

  12. J. Gu , L. X Huang, Y. Shen , L. H. Huang , and Q. L. Feng 2012. Hsp70 and small Hsps are the major heat shock protein members involved in midgut metamorphosis in the common cutworm, Spodoptera litura. Insect Mol. Biol. 21(5): 535–543. Google Scholar

  13. L. H. Huang , B. Chen , and L. Kang 2007. Impact of mild hardening on thermotolerance, fecundity, and Hsp gene expression in Liriomyza huidobrensis. J. Insect. Physiol. 53: 1199–1205. Google Scholar

  14. L. H. Huang , and L. Kang 2007. Cloning and interspecific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Insect Mol. Biol. 16: 491–500. Google Scholar

  15. M. X. Jiang , W. J. Zhang , and J. A. Cheng 2004. Termination of reproductive diapause in the rice water weevil with particular reference to the effects of temperature. Appl. Entomol. Zool. 39(4): 683–689. Google Scholar

  16. J. G. Kiang , and G. C. Tsokos 1998. Heat Shock Protein 70 kDa, Molecular Biology, Biochemistry, and Physiology. Pharmacol. Therapeut. 80(2): 183–201. Google Scholar

  17. J. J. Kim , K. B. Uhm , J. O. Lee , and K. C. Kim 1996. Effect of water management on the rice water weevil, Lissorhoptrus oryzophilus (Coleoptera, Curculionidae), under the three different rice culture methods. RDA J. Agric. Sci. 38: 445–456. Google Scholar

  18. S. Kobayashi , G. Toyoshima , and N. Morimoto 1997. Occurrence and population density of the rice water weevil, Lissorhoptrus oryzophilus Kuschel (Coleoptera, Curculionidae) in the higher and lower elevation areas of Nagano Prefecture. Appl. Entomol. Zool. 32: 9–18. Google Scholar

  19. W. H. Lange , and A. A. Grigarick 1959. Rice water weevil. Beetle pest in rice growing areas of southern states discovered in California. California Agric. 13: 10–11. Google Scholar

  20. W. Levinson , H. Oppermann , and J. Jackson 1980. Transition series metals and sulfhydryl reagents induce the synthesis of four proteins in eukaryotic cells. Biochim. Biophys. Acta 606: 170–180. Google Scholar

  21. S. Lindquist , and E. A. Craig 1988. The heat-shock proteins. Annu. Rev. Genet. 22: 631–677. Google Scholar

  22. M. Macnair 1997. The evolution of plants in metalcontaminated environments. Environ Stress, Adapt. Evol. 83: 4–24. Google Scholar

  23. T. Mbaye , F. Bonhomme , D. J. McKenzie , and J. D. Durand 2010. Differential expression of the heat shock protein Hsp70 in natural populations of the tilapia, Sarotherodon melanotheron, acclimatised to a range of environmental salinities. BMC Ecol 10(1):11. Google Scholar

  24. S. H. H. Moghaddam , X. Du , J. Li , J. R. Cao , B. X. Zhong , and Y. Y. Chen 2008. Proteome analysis on differentially expressed proteins of the fat body of two silkworm breeds, Bombyx mori, exposed to heat shock exposure. Biotechnol. Bioproc. E 13(5): 624– 631. Google Scholar

  25. R. I. Morimoto , A. Tissieres , and C. Georgopulos 1994. The Biology of Heat Shock Proteins and Molecular Chaperones. New York: Cold Spring Harbor Lab Press. 610 pp. Google Scholar

  26. G. Morrow , and R. M. Tanguay 2012. Small heat shock protein expression and functions during development. Intl. J. Biochem. Cell B 44: 1613–1621. Google Scholar

  27. D. A. Parsell , and S. Lindquist 1993. The function of heat-shock proteins in stress tolerance, degradation and reactivation of damaged proteins. Annu. Rev. Genet. 27: 437–496. Google Scholar

  28. P. Raksarart , and N. P. Tugwell 1975. Effect of temperature on development of rice water weevil eggs. Environ. Entomol. 4(4): 543 – 544. Google Scholar

  29. J. P. Rinehart , and D. L. Denlinger 2000. Heatshock protein 90 is down-regulated during pupal diapause in the flesh fly, Sarcophaga crassipalpis, but remains responsive to thermal stress. Insect Mol. Biol. 9(6): 641–645. Google Scholar

  30. J. P. Rinehart , A. Li , G. D. Yocum , R. M. Robich , S. A. L. Hayward , and D. L. Denlinger 2007. Upregulation of heat shock proteins is essential for cold survival during insect diapause. Proc. Natl. Acad. Sci. USA 104(27): 11130–11137. Google Scholar

  31. J. P. Rinehart , R. M. Robich and D. L. Denlinger 2006. Enhanced cold and desiccation tolerance in diapausing adults of Culex pipiens, and a role for Hsp70 in response to cold shock but not as a component of the diapause program. J. Med. Entomol. 43(4): 713 –722. Google Scholar

  32. J. P. Rinehart , G. D. Yocum , and D. L. Denlinger 2000. Developmental upregulation of inducible Hsp70 transcripts, but not the cognate form, during pupal diapause in the flesh fly, Sarcophaga crassipalpis. Insect Biochem. Mol. Biol. 30: 515–521. Google Scholar

  33. M. J. Schlesinger 1990. Heat shock proteins. J. Biol. Chem. 265: 12111–12114. Google Scholar

  34. H. W. Shang 2003. Population ecology and management strategy of the rice water weevil, Lissorhoptenus oryzophilus Kuschel. Zhejiang University PhD Dissertation. 208 pp. Google Scholar

  35. H. P. Shih , and C. H. Cheng 1993. Present status of the rice water weevil, Lissorhoptrus oryzophilus Kushel in Taiwan, pp. 104 –121 In K. Hirai [ed.], Establishment, spread and management of the rice water weevil and migratory rice insect pests in East Asia. Tsukuba: Japan NARC. Google Scholar

  36. B. J. Sinclair , A. G. Gibbs , and S. P. Roberts 2007. Gene transcription during exposure to, and recovery from, cold and desiccation stress in Drosophila melanogaster. J. Insect Mol. Biol. 16: 435–443. Google Scholar

  37. M. J. Stout , M. R. Riggio , L. Zou , and R. Roberts 2002. Flooding influences ovipositional and feeding behavior of the rice water weevil (Coleoptera, Curculionidae). J. Econ. Entomol. 95: 715–721. Google Scholar

  38. S. I. Tachibana , H. Numata , and S. G. Goto 2005. Gene expression of heat-shock proteins (Hsp23, Hsp70 and Hsp90) during and after larval diapauses in the blow fly Lucilia sericata. J. Insect Physiol. 51(6): 641–647. Google Scholar

  39. J. M. Velazquez , S. Sonoda , G. Bugaisky , and S. Lindquist 1983. Is the major Drosophila heat shock protein present in cells that have not been heat shocked? J. Cell Biol. 96: 586–290. Google Scholar

  40. H. Wang , S. Z. Dong , K. Li , C. Hu , and G. Y. Ye 2008. A heat shock cognate 70 gene in the endoparasitoid, Pteromalus puparum, and its expression in relation to thermal stress. BMB Rep. 388–393. Google Scholar

  41. M. O. Way 1990. Insect pest management in rice in the United States, pp. 181–189 In B. T. Grayson , M. B. Green and L. G. Copping [eds.], Pest Management in Rice. Elsevier Applied Science Publishers, London. Google Scholar

  42. K. Wei and W. Chen 2009. Climatology and trends of high temperature extremes across China in Summer. Atomos. Oceanic Sci. Lett. 2(3): 153–158. Google Scholar

  43. L. H. Yang , H. O. Jiang , Y. H. Liu , W. Dou , and J. J. Wang 2012. Molecular characterization of three heat shock protein70 genes and their expression profiles under thermal stress in the citrus red mite. Mol. Biol. Rep. 39: 3585–3596. Google Scholar

  44. P. Yang , W. W. Zhou , Q. Zhang , J. A. Cheng , Z. R. Zhu , and M. O. Way 2009. Differential gene expression profiling in the developed ovaries between the parthenogenetic and bisexual female rice water weevils, Lissorhoptrus oryzophilus Kuschel (Coleoptera, Curculionidae). Chinese Sci. Bull. 54: 3822–3829. Google Scholar

  45. G. D. Yocum 2001. Differential expression of two Hsp70 transcripts in response to cold shock, thermoperiod, and adult diapause in the Colorado potato beetle. J. Insect Physiol. 47: 1139–1145. Google Scholar

  46. G. D. Yocum , K. H. Joplin , and D. L. Denlinger 1998. Upregulation of a 23 kDa small heat shock protein transcript during pupal diapause in the flesh fly, Sarcophaga crassipalpis. Insect Biochem. Mol. Biol. 28: 677–682. Google Scholar

  47. G. D. Yocum , K. H. Joplin , and D. L. Denlinger 1991. Expression of heat shock proteins in response to high and low temperature extremes in diapausing pharate larvae of the gypsy moth, Lymantria dispar. Arch. Insect Biochem. 18: 239–249. Google Scholar

  48. B. P. Zhai , J. A. Cheng , E. Y. Huang , H. W. Shang , X. H. Zheng , J. Wu , Y. J. Fang , W. Q. Xia , X. J. Lu 1997. Population dynamics of rice water weevil in double rice cropping area of Zhejiang province, China. Sci. Agric. Sinica 30(6): 23–29. In Chinese with English summary. Google Scholar

  49. B. P. Zhai , J. A. Cheng , and X. H. Zheng 1999. On the formation of destructive population of rice water weevil in double rice cropping area of Zhejiang Province, China. Acta Phytophylacica Sinica 26: 137–141 (in Chinese with English summary). Google Scholar

  50. Z. R. Zhu , H. W. Shang , and M. X. Jiang 2005. The rice water weevil. Biology and management of important agricultural and forest invasive species, pp. 129–176 In F. H. Wan , X. B. Zheng and J. Y. Guo [eds], Biology and Management of Invasive Alien Species in Agriculture and Forestry. Beijing: China Science Press, (in Chinese with English abstract).  Google Scholar

Notes

[1] Supplementary material for this article in Florida Entomologist 97(2) (June 2014) is online at  http://purl.fcla.edu/fcla/entomologist/browse

Xin Yuan, Wen-Wu Zhou, Ying Zhou, Su Liu, Fang Lu, Mao-Fa Yang, Jiaan Cheng, Geoff M Gurr, and Zeng-Rong Zhu "Composition and Expression of Heat Shock Proteins in an Invasive Pest, The Rice Water Weevil (Coleoptera: Curculionidae)," Florida Entomologist 97(2), 611-619, (1 June 2014). https://doi.org/10.1653/024.097.0237
Published: 1 June 2014
JOURNAL ARTICLE
9 PAGES


SHARE
ARTICLE IMPACT
Back to Top