Many environmental factors affect the distribution of species in nature such as temperature and humidity (Gibbs et al. 2003), chemicals and heavy metals (Macnair 1997). Thermal environments often vary spatially and temporally across the geographic range of a species, and such variation can be an important selection force leading to genetic divergence among local populations (Angilletta 2009). When individuals in a population are exposed to stressful conditions, there are 3 possible outcomes, i.e., they avoid the stress, they adapt to the stress, or they are killed (Hoffmann et al. 1991). There is, however, a particular set of proteins, named heat stress proteins (Hsps), that are preferentially expressed under stress (Peter et al. 2002). These are highly-conserved molecules that are categorized into several subgroups according to size, structure and function (Lindquist et al. 1988; Boorstein et al. 1994; Richter et al. 2010). Expression of Hsps is increased when the cells are exposed to elevated temperatures, and they are induced in cells exposed to sub-lethal heat shock (Kiang & Tsokos 1998). The heat shock response was first discovered by Ritossa (1962) in Drosophila melanogaster Meigen (Drosophilidae). The induction of Hsps occurs under circumstances relevant to the environment of the species, such that in arctic fish Hsps are induced around 5 °C and in thermophilic bacteria around 100 °C (Parsell et al. 1993). Hsp families are known to be important in the biology of insects. For example, small heat shock proteins and Hsp70 are related to thermo-tolerance in the silkworm (Bombyx mori [L.]; Bombycidae) (Moghaddam et al. 2008).

In addition to their role in thermal tolerance, Hsps can be induced by a variety of other stimuli, and they play broader roles. Members of the Hsp70 family in particular are constitutively expressed in cells under normal conditions and function as molecular chaperones, to keep other proteins from forming inappropriate aggregations (Mbaye 2010). As well as being induced by a variety of stresses, Hsp expression can vary with the physiological state of the organism and developmental stage (Feder et al. 1999). For example, Hsp23 and Hsp70 of the flesh fly, Sarcophaga crassipalpis Macquart (Sarcophagidae), are highly up-regulated during diapause (Yocum et al. 1998; Rinehart et al. 2000). Similarly, one of the 2 copies of Hsp70 gene in diapausing adults of Colorado potato beetle, Leptinotarsa decemlineata Say (Chrysomelidae), is up-regulated (Yocum 2001). In the gypsy moth, Lymantria dispar (L.) (Erebidae), Hsp70 is not expressed at the initiation of diapause, but only after exposure to low temperature (Yocum et al. 1991). Notwithstanding the similarities in the role of Hsps in the foregoing examples, there is no fixed expression pattern of Hsp genes among different species. Accordingly, this study was aimed to elucidate the expression pattern of Hsps in the rice water weevil, Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae), an invasive pest species that has not been the subject of earlier studies of its capacity to tolerate environmental stresses.

The rice water weevil originates from the Mississippi River Valley of the USA (Lange & Grigarick 1959). Parthenogenetic females were found in rice in California in 1959. This species has subsequently come to be considered as an important pest of this crop (Godfrey & Espino 2009). Lissorhoptrus oryzophilus has invaded parts of eastern Asia since the 1970s (Way 1990; Kim et al. 1996; Kobayashi et al. 1997; Zhai et al. 1999; Stout et al. 2002; Zhu et al. 2005). In China, the world's largest rice producer, this pest was first detected in Hebei Province in 1988 and is now found over an extensive area from Jilin Province (N 41° – N 46°) to Yunnan Province (N 23° – N 25°) where the climate ranges from temperate to tropical. Lissorhoptrus oryzophilus is able to overwinter in the temperate parts of its range as well as to tolerate seasonally high temperatures in summer; thus it possesses effective mechanisms for coping with thermal stress.

Diapause, the arrest of development or normal activity during adverse environmental conditions (Chapman 1998), is suggested as the means for over-summering and over-wintering by the weevil in its large geographical range (Jiang et al. 2004; Zhu et al. 2005). However, whether the Hsps play a role in diapause remains unclear.

To investigate the relationship between the expression pattern of Hsp genes and temperature stress, firstly, we searched for all Hsp genes in the L. oryzophilus transcriptome database. Secondly, we exposed insects to the sub-lethal low and high temperatures of 0 °C and 43 °C for 0.5 - 3 h to identify the expression patterns of Hsps under thermal stress. Thirdly, we compared the expression of Hsps between diapausing and nondiapausing L. oryzophilus female adults.

Materials and Methods

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

To measure expression of Hsp genes, qRTPCR was used with the primer pair detailed in Table 1. A pre-run test was carried out to confirm the constant expression of the actin and tubulin genes in each sample. Tubulin was used as a normalization gene with the forward primer 5′- GCCTGCTGGGAACTGTATTGTT -3′ and the reverse primer 5′- CGCCGAAAAACGTGTTAAAAC -3′ with an expected product size of 100 bp. Amplifications were performed using Thunderbird SYBR qPCR Mix (Toyobo, Japan) and 5 pmol of each primer. To ensure the validity of the data, the expression of each gene was tested in triplicate in each of 3 biologically independent experiments. Each RNA sample in each replicate was prepared from 3 individuals. The cycling conditions were: (1) 95 °C, 30 s; (2) 95 °C, 5 s; (3) 60 °C, 30 s; (4) go to 2, 40 cycles. A CFX96 machine (Bio-Rad, USA) and the accompanying software were used for qRT-PCR data normalization and quantification.

After the qRT-PCR assay, results were normalized to the expression level of the tubulin reference gene. The relative quantitative method (ΔΔCt) was used to evaluate the expression levels (Lival et al 2001). Arbitrary cut-offs of 2.0 × and 0.5 × relative expression ratios compared to that of the reference gene were set as thresholds of up-regulation and down-regulation, respectively.

Table 1.

Primers for qrt-pcr of heat shock proteins of the rice water weevil, Lissorhoptrus oryzophilus.

Results

In order to facilitate clarity, the deduced alignments of amino acids of heat shock protein families of the rice water weevil are shown with color coding of the various amino acids in Suppl. Fig. 1, which can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse. Also a colored version of each of several other figures are found in the supplementary material.

Multiple Sequence Alignment

Small Hsps showed relatively low identities, the most divergent of protein sequences were identical at 36% (Table 2). Hsp60, Hsp70 and Hsp90 family members were more conserved. The most divergent of these protein sequences were 83%, 86% and 62% identical, respectively (Table 2). Deduced amino acid sequences of Hsp60, Hsp70 and Hsp90 of L. oryzophilus were compared with corresponding genes of Tribolium castaneum (Herbst) (Tenebrionidae) (Suppl. Fig. 1).

Fig. 1.

Relative expression of L. oryzophilus small Hsps under cold stress (0 ˚C) compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

Table 2.

Lissorhoptrus oryzophilus heat shock protein (Lohsps) genes and their similarities with those of other species.

Response to Heat Stress

Under heat stress, more Hsps were up-regulated including Hsp70, Hsp90 and the small Hsp families (Figs. 3 and 4), than under cold stress (Figs. 1 and 2). Four small Hsp genes (LoHsp21h, LoHsp20.6, LoHsp21b, LoHsp21e) were up-regulated when exposed for 0.5 h, and up-regulation reached its peak at 1 h, then declined though remaining higher than in the control except for LoHsp21e. These 4 small Hsps showed a similar expression pattern (Fig. 3). One Hsp70 gene (LoHsp70d) was especially strongly up-regulated starting from 0.5 h, reached a peak of expression at 2 h, then declined but was still up-regulated compared to the control. In total, 2 Hsp70 genes (LoHsp70d and LoHsp70e) and 2 Hsp90 genes (LoHsp90b and LoHsp90c) were up-regulated after heat treatment (Fig. 4).

The weevils underwent a series of physiological changes during the diapause stage. No Hsp gene was up-regulated in the diapausing adult females, while 4 small Hsps (LoHsp20.6, LoHsp21d, LoHsp21i, LoHsp23), 1 Hsp60 (LoHsp60), 1 Hsp70 (LoHsp70a) and 2 Hsp90s (LoHsp90a, LoHsp90b) were down-regulated (Fig. 5).

Fig. 2.

Relative expression of L. oryzophilus Hsp60, Hsp70 and Hsp90 genes under cold stress compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

Fig. 3.

Relative expression of L. oryzophilus small Hsps under heat stress compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

Fig. 4.

Relative expressions of L. oryzophilus Hsp60, Hsp70 and Hsp90 genes under heat stress compared to non-stressed controls. A colored version of this figure can be found in supplementary material for this article in Florida Entomologist 97(2) (June 2014) online at  http://purl.fcla.edu/fcla/entomologist/browse

Discussion

In all organisms examined, from Archeobacteria to humans, temperature elevation above the normal physiological temperature leads to a heat shock response, which consists of a profound alteration of gene expression (Morimoto et al. 1994). In the present study, the cDNA sequences of 12 small Hsp, 1 Hsp60, 5 Hsp70 and 3 Hsp90 genes were determined. These Hsp genes are the first determined in the largest family (Curculionidae) of the largest insect order (Coleoptera). Of specific importance are the 8 genes belonging to the Hsp90s, Hsp70s, and small Hsp families that were up-regulated under heat stress and the 1 Hsp70 and 1 Hsp90 gene that were up-regulated under cold stress. Results indicate that Hsp70s, Hsp90s and small Hsps were responsible for adapting to the temperature stress of L. oryzophilus. Hsp expression under thermal stress provided an interesting contrast to the typical stress response in which all Hsps are up-regulated. The experimental system was specifically designed to focus on heat and cold shock response to short stressful conditions, which demonstrated that L. oryzophilus has the capacity to adapt to temperature stress under extreme unpredictable environmental events, either during their invasion process by non-intentional human transportation or in overwintering post-arrival in new habitats. Our results showed that certain Hsp70, Hsp90, and small Hsp genes were strongly up-regulated under heat stress and this up-regulation can extend over several hours. Under cold stress, in contrast, only 1 Hsp70 and 1 Hsp90 genes were slightly up-regulated. The expression of 2 small Hsps (LoHsp12.2 and LoHsp21g) was not affected by temperature, suggesting that they are involved in other, non-thermal tolerance roles in the insect's biology. For example, Gu et al. (2012) found that Hsp70 and small Hsps are involved in midgut metamorphosis in the common cutworm, Spodoptera litura (F.) (Noctuidae). Small heat shock proteins also help to protect cells from apoptosis, stabilize the cytoskeleton and contribute to proteostasis as housekeeping proteins (Morrow & Tanguay 2012).

Hsp70 proteins have been discovered in a wide range of species and their structure and function is highly conserved (Schlesinger 1990). Up-regulation of Hsp70 mRNA levels in response to low temperature has been reported in insects from various orders (Sinclair et al. 2007; Huang et al. 2007; Yocum 2001; Wang et al. 2008; Elekonich 2009; Yang et al. 2012). In the present study, 1 of the 5 Hsp70 genes was up-regulated in L. oryzophilus exposed to low temperature for 3 h. In contrast, 2 Hsp70 genes and 2 Hsp90 genes were up-regulated in L. oryzophilus exposed to high temperature. More small Hsp genes were involved in the adaptation to the heat stress, and those 2 Hsp70s and Hsp90s were continuously up-regulated across the stress. Yang et al. (2012) showed that Hsp70s were more critical to coping with heat stress than cold shock. Hsp70 responds dramatically to either heat or cold shock, which can induce a thousand-fold response (Velazquez et al. 1983; Huang & Kang 2007).

Fig. 5.

Relative expression of Hsp genes in diapausing adult females compared to non-diapausing controls.

The involvement of Hsp in insect diapause has been studied in several species. In the flesh fly, S. crassipalpis, most but not all Hsps are up-regulated during diapause. Although many reports suggest that Hsps are associated with diapauses (Rinehart et al. 2000, 2007; Yocum et al. 1998), this is not the case in all studied insects. For example, Hsps do not appear to be up-regulated in Drosophila triauraria Bock & Wheeler during diapause (Goto et al. 1998, 2004), but were in larval diapause of Lucilia sericata Meigen (Calliphoridae) (Tachibana 2005) and adult diapause of Culex pipiens L. (Culicidae) (Rinehart et al. 2006). Expression patterns of heat shock protein genes are highly variable among species that undergo diapause. The present study showed that no Hsp gene was up-regulated but 4 small Hsps, 1 Hsp60, 1 Hsp70 and 2 Hsp90 genes were down-regulated during the diapause of L. oryzophilus. Rinehart & Denlinger (2000) reported 1 Hsp90 is downregulated during pupal diapause in the flesh fly, S. crassipalpis, but remained responsive to thermal stress, indicating that even a down-regulated protein can be involved in thermal stress.

There is no fixed pattern for the expression of Hsps. Further, heat shock is not the only environmental stress that can induce the expression of Hsps. Other factors such as heavy metals (Levinson et al. 1980); protein kinase C timulators (Ding et al. 1996); Ca²⁺ increasing agents (Ding et al. 1998) also can induce Hsp expression. Different proteins in the same family can show different expression patterns under the same treatment. In the present study LoHSP70e, LoHSP70b, LoHSP70c and LoHSP70d belong to Hsp70 family, but showed varied expression ratios after cold and heat shocks. When the weevils were exposed to 43 °C, the expression ratios for these 4 Hsp70 genes varied strongly. LoHSP70d and LoHSP70e were strongly up-regulated while the other 2 Hsp70 genes showed no difference between treatment and no-treatment. The precise roles of different Hsps are still not fully understood. Further study should consider this group of proteins in coping with thermal stress and possibly other environmental challenges encountered by invading species.