Translator Disclaimer
1 June 2013 Infections with the Microbe Cardinium in the Dolichopodidae and Other Empidoidea
Author Affiliations +
Abstract

Maternally transmitted reproductive parasites such as Wolbachia and Cardinium can drastically reshape reproduction in their hosts. Beyond skewing sex ratios towards females, these microbes can also cause cytoplasmic incompatibility. Wolbachia probably infects two thirds of insects, but far less is known about the occurrence or action of other bacteria with potentially similar effects. In contrast with the two more widespread reproductive parasites, Wolbachia and Spiroplasma, far less is known of infections with Cardinium (Bacteroidetes) and possible consequences in the Diptera. Here, in an extensive survey, 244 dipteran species from 67 genera belonging to the Dolichopodidae, Empididae, and Hybotidae were assessed for the presence of the microbe Cardinium. Although 130 of the species screened tested positive (ca. 53%), the presence of Cardinium could only be confirmed in 10 species (ca. 4%) based on analysis of sequences. Numerous additional sequences were found to be assignable to known or unknown Bacteroidetes.

Considering the known issues concerning specificity of Cardinium primers and the phylogenetic uncertainties surrounding this microbe, the actual prevalence of this symbiont is worthy of further scrutiny. Potential directions for future research on Cardinium-host interactions in Diptera and in general are discussed.

Introduction

Maternally inherited reproductive parasites such as Wolbachia, Rickettsia, and Spiroplasma species are known to have profound effects on reproduction and behavior (e.g., Goodacre et al. 2009) of their hosts (reviewed in Engelstädter and Hurst 2008; Goodacre and Martin 2012). More recently, a further reproductive parasite, Cardinium hertigii (Bacteroidetes) (Zchori-Fein et al. 2004), has been described. Cardinium infections were first observed in ticks (Kurtti et al. 1996), and are found in a wide range of spiders, mites, and other arachnids (Zchori-Fein and Perlman 2004; Chigira and Miura 2005; Groot and Breeuwer 2006; Enigl and Schausberger 2007; Duron et al. 2008b; Gruwell et al. 2009; Martin and Goodacre 2009; Chang et al. 2010; Breeuwer et al. 2012). Although this microbe seems to be more common in arachnids, it is also known to infect insects (Zchori-Fein and Perlman 2004; Provencher et al. 2005; Bigliardi et al. 2006; Marzorati et al. 2006; Sirviö and Pamilo 2010).

Cardinium is now known to cause three of the four classic phenotypes often associated with reproductive parasites: cytoplasmic incompatibility in the parasitoid wasp Encarsia pergendiella (Hunter et al. 2003), the spider mite Bryobia sarothamni (Ros and Breeuwer 2009), and the tetranychid mites Eotetranychus suginamensis (Gotoh et al. 2006) and Tetranychus cinnabarinus (Xie et al. 2010); feminization in Brevipalpus mites (Weeks et al. 2001); and parthenogenesis in the hemipteran Aspidiotus nerii (Provencher et al. 2005) and in Encarsia species (Zchori-Fein et al. 2001; 2004). In contrast to the better-known symbionts Wolbachia and Spiroplasma, the parasite Cardinium has so far not been found to be associated with male-killing.

Surveys for infections with the two more common reproductive parasites, Wolbachia and Spiroplasma, are available for many arthropods (e.g., for spiders: Goodacre et al. 2006). Within the Diptera, previous extensive surveys have focused on the genus Drosophila (Clark et al. 2005; Mateos et al. 2006), the Empidoidea (Martin et al. 2013), and the Muscoidea, including the yellow dung fly, Scathophaga stercoraria (Martin et al. 2012). Both these symbionts have been shown to manipulate host reproduction in flies. Wolbachia causes cytoplasmic incompatibility in Culex pipiens (Yen and Barr 1971), and Spiroplasma is associated with male-killing in Drosophila willistoni (Hackett et al. 1986). Wolbachia has also been shown to affect other reproductive traits in Drosophila. Specifically, the parasite increases male mating rate (Champion de Crespigny et al. 2006) and decreases sperm competitive ability (Champion de Crespigny and Wedell 2006). However, knowledge of infections with Cardinium and possible consequences in the Diptera lags far behind.

As outlined above, Diptera, and especially Drosophila flies, have been instrumental in furthering the understanding of hostreproductive parasite interactions. With over 7,100 species worldwide, the Dolichopodidae, long-legged flies, represent one of the most speciose families in the Diptera (Pape et al. 2009). The actual number of taxa is presumably higher, especially in the tropics, where dozens of new taxa are discovered every year (e.g., Bickel 2009). The greatest diversity and abundance of long-legged flies are found at humid sites, and the flies show high potential as bio-indicators for natural quality assessments of biotopes due to their specific habitat requirements (Pollet 2009). Adult and larval stages of most species feed on small soft-bodied arthropods (Ulrich 2004), and because of this they are considered to be of potential use in biocontrol. Finally, their elaborate courtship behavior and their conspicuous male secondary sexual characters further provide excellent opportunities for studying sexual selection and speciation processes (Germann et al. 2010; Martin et al. 2013). This is particularly relevant, as reproductive parasites have been shown to have profound effects on reproductive traits and potential involvement in reproductive isolation (Wade and Stevens 1985), with obvious direct links to the study of sexual selection (discussed in Martin et al. 2012; 2013).

Considering the dramatic effects the microbe Cardinium can have on its arthropod hosts, it is important to acquire further knowledge, both concerning the range of hosts affected and the precise consequences of infection. Moreover, it has been suggested that a greater range of arthropods should be screened in order to achieve a better understanding of Cardinium phylogenetic diversity (Nakamura et al. 2009). Surprisingly, knowledge of Cardinium infections within the Diptera remains particularly hazy. Here, 244 fly species from 67 genera belonging to the Dolichopodidae, Empididae, and Hybotidae (all superfamily Empidoidea) were surveyed for the presence of this reproductive parasite (as also done for Wolbachia, Spiroplasma, and Rickettsia in Martin et al. 2013).

Methods

Samples, DNA extraction, amplification

Extensive DNA samples from previous studies (Bernasconi et al. 2007a; 2007b; Germann et al. 2010; 2011ab; Pollet et al. 2010; 2011) and a few additional fly samples were used to assess a range of representatives of the Dolichopodidae and species from other empidoid families, namely Empididae and Hybotidae, for infection with Cardinium via PCR (see Martin et al. 2013 for data on three other symbionts). DNA was extracted from whole fly specimens using DNeasy Tissue kits (Qiagen AG,  www.qiagen.com) according to the manufacturer's instructions. Whole specimens were triturated mechanically in microtubes using a TissueLyser (Mixer Mill MM 300, Qiagen AG). Following digestion with Proteinase K (2 µg/mL), samples were applied to the columns for DNA absorption and washing. Finally, DNA was eluted in 200 µl of the buffer from the kit and stored at -20° C. All the extracted fly specimens were deposited at the Zoological Museum, Institute of Evolutionary Biology and Environmental Studies, University of Zurich. Standard PCR reactions were performed with 2 µl of the extracted DNA as template, 1 µl of each primer (10 µM), 12.5 µl Master Mix (250 units, HotStarTaq Master Mix Kit, Qiagen AG), and 8.5 µl distilled H2O, for a total volume of 25 µl (manufacturer's buffer). The following specific primers (Microsynth GmbH,  www.microsynth.ch) were used: Cardinium (16S rDNA gene), CardiniumCh-F: TACTGTAAGAATAAGCACCGGC, and CardiniumCh-R: GTGGATCACTTAACGCTTTCG (ZchoriFein and Perlman 2004). The PCR reaction mixtures were subjected to 10 min DNA denaturation at 95° C, 50 cycles of denaturation at 94° C for 30 sec, annealing at 50° C for 20 sec, and elongation at 72° C for 30 sec. Elongation was completed by a further 7 min step at 72° C. PCR reactions were performed in a DNA Thermal Cycler (Perkin-Elmer Applied Biosystems,  www.perkinelmer.com). Purification of PCR products for direct sequencing was performed by adding 0.5 µl (1 U/µl) Shrimp Alkaline Phosphatase (Promega AG,  www.promega.com), 0.25 µl (20 U/µl) Exonculease I (New England Biolabs (Bioconcept),  www.neb.com), and 24.25 µl distilled H2O (ratio of PCR product and ExoSap-mix 1:1) to each PCR product. The ExoSAP protocol consisted of 45 min incubation at 37° C and 15 min deactivation at 80° C. Cycle sequencing reactions were performed in total volumes of 10 µl using an ABI Prism Big Dye Terminator Cycle Sequencing Kit (Perkin-Elmer Applied Biosystems) on an ABI 3730 DNA Analyser (Perkin-Elmer Applied Biosystems), again following the manufacturer's instructions.

Negative and positive controls were used during the amplification procedures. The negative controls consisted of micro-tubes/positions in the reaction plates containing all the necessary reagents, except that the extracted genomic DNA to be amplified was substituted with distilled H2O. Positive controls consisted of extracted genomic DNA of samples infected with the microorganism under study (for the PCR) or in purified PCR products (for the direct sequence). Results of PCR amplification were visualized via Gel Electrophoresis.

DNA sequence analyses

Gene sequences were handled and stored using the Lasergene program Editseq (DNAstar Inc.,  www.dnastar.com). Sequence alignment was performed using the Clustal W method as implemented in Megalign (DNAstar Inc.) using the default multiple alignment parameters (gap penalty =15; gap length penalty = 6.66; delay divergent sqs (%) = 30; DNA transition weight = 0.50). All obtained microbial sequences were checked in GenBank using the BLAST tool to verify their identity, i.e., to determine their similarity to known Cardinium sequences or, conversely, to find out their possible identity as other Bacteroidetes or unknown (taxonomically undescribed) bacteria.

Results

Out of the 244 species screened, over half of the species tested positive (130/244, ca. 53%; see results of PCR survey displayed in Table 1), with positives found across all three families surveyed. At the genus level, the following patterns were observed: in the Empididae, five out of seven genera (ca. 71%) tested positive, compared with 4/9 (ca. 44%) in the Hybotidae and 35/51 (ca. 69%) in the Dolichopodidae (sensu lato + sensu stricto; see Pollet and Brooks 2008). However, subsequent sequencing of amplicons, and searching for most closely related bacterial sequences, indicated that not all of these positives can be assigned to Cardinium. Of the 169 sequences amplified, 15 had to be discarded because the quality was too poor to allow analysis. Of the remaining 154, only 10 of the sequences came out as clearly assignable to Cardinium (see overview in Table 2). These sequences stem from species from five subfamilies within the Dolichopodidae s. stricto representing the genera Argyra, Chrysotus, Medetera, Peleropeodes, Sciapus, and Tachytrechus. In six cases, the closest matches were sequences obtained from three hemipterans (Table 2). The other sequences matched either the hymenopteran Plagiomerus diaspidis, the copepod Nitocra spinipes, or the spider mite Tetranychus cinnabarinus (Table 2).

A further 50 sequences could be assigned to other Bacteroidetes as either known or unknown microbes (N = 27) (Table 2). The remaining sequences belonged to the Proteobacteria, including 13 matching the opportunistic pathogen Pseudomonas (see D'Argenio et al. 2001). A sequence obtained from one Dolichopusplumipes sample closely matched the pathogen Rickettsiella tipulae (Gammaproteobacteria), known to infect the crane fly, Tipula paludosa (Leclerque and Kleespies 2008; Bouchon et al. 2012). The remaining sequences were either unknown Proteobacteria (N = 28) or unknown bacteria (N = 38).

Discussion

The species from the Dolichopodidae, Empididae, and Hybotidae assessed here seemed to show a high proportion of infections based on PCR results alone. This would be noteworthy, as Cardinium is generally thought to be less widespread than other symbionts such as Wolbachia and Spiroplasma. Whereas Wolbachia is thought to infect ca. 66% of insects (Hilgenboeker et al. 2008), previous surveys indicated that Cardinium may be much rarer overall in arthropods and are perhaps restricted to particular groups, such as Hemiptera (see Nakamura et al. 2009). For example, extensive surveys across spiders and other arachnids indicated that proportions of infected samples were generally higher than in insects (Weeks et al. 2003; Duron et al. 2008b; Martin and Goodacre 2009). Nevertheless, Zchori-Fein and Perlman (2004) included 85 insect species in their study, and found that only 6% of species screened tested positive for Cardinium versus 24% positive for Wolbachia. This low prevalence in insects was mirrored in our study, as a similar prevalence of ca. 4% (10/244) was found using only those infections that were confirmed via direct sequencing.

Concerning the more specific situation in Diptera, some fly species have been assessed as part of more general surveys encompassing various arthropod groups. Zchori-Fein and Perlman (2004) assessed 11 species of Diptera as part of their survey: Lucilia ciricata (Calliphoridae); Asphondylia capparis, Dasineuriola sp., and Schizomyia sp. (Cecidomyiidae); Culicoides circumscriptus and C. imicola (Ceratopogonidae); Culex pipiens (Culicidae); Drosophila melanogaster and D. simulans (Drosophilidae); Musca domestica (Muscidae); and Ceratitis capitata (Tephritidae). C. pipiens and the two species of Drosophila were found to be infected with Wolbachia, but none of the species assessed were infected with Cardinium. Similarly, no infections with Cardinium were found in a survey of 181 strains representing 35 species of Drosophila (Mateos et al. 2006). Duron et al. (2008) also surveyed 25 dipteran species as part of a larger survey and, again, found no evidence for infections with Cardinium. Finally, Nakamura et al. (2009) assessed Culicoides biting midges and described infections with a new Cardinium group in four out of 25 species tested. Here, the first extensive survey specifically assessing possible infections with Cardinium in a wider range of fly species is provided, and the presence of Cardinium in 10 species from six genera is confirmed. So far, to our knowledge, our survey represents the only evidence for infections with Cardinium in Diptera other than Culicoides (Nakamura et al. 2009).

The majority of sequences could not be assigned to Cardinium, although numerous sequences were assignable to other Bacteroidetes within the survey. Some of these sequences may well represent Cardinium infections, so this possibility definitely warrants further scrutiny. However, it must also be noted that the situation is complicated by the fact that the phylogenetic relationships within Cardinium are still confused and hence remain fluid (see Gruwell et al. 2009; Nakamura et al. 2009; Perlman et al. 2010; discussed in Breeuwer et al. 2012). To a certain extent, this problem also applies to reproductive parasites in general; for example, whether the far more intensively studied Wolbachia represents one or two species is still debated (Lo et al. 2007; Pfarr et al. 2007). This problem may be additionally compounded by general issues of false negatives inherent to PCR-based screening (see Breeuwer et al. 2012), so overall, it is likely that frequency of infection with symbionts is being underestimated and novel bacteria are being missed (see e.g., Weinert et al. 2007). In our study, the Ch primer set (Zchori-Fein and Perlman 2004) was used, as this primer pair is commonly used for detection of Cardinium (Breeuwer et al. 2012). Further work would be needed to resolve the issue, and one option would be to use more than one primer pair, or supplement molecular data with morphological analysis, as done by Nakamura et al. (2009). If some of these sequences are in fact Cardinium, the microbe may be a more widespread symbiont of arthropods than previously assumed.

Unsurprisingly, considering the glaring paucity of knowledge concerning the range of Dipteran species infected, so far nothing at all is known of the consequences of infection for hosts in this group. Now that it has been established that Cardinium can infect additional dipteran hosts from an important group in the context of sexual selection, it would be worthwhile to investigate potential consequences. As noted above, Cardinium can cause sex ratio distortion or reproductive alterations in its hosts. So far, research has demonstrated association with parthenogenesis in Hemiptera, parthenogenesis and cytoplasmic incompatibility in Hymenoptera, and cytoplasmic incompatibility and feminization in Acarida (reviewed in Duron et al. 2008a). Effects need not be so drastic though, as Cardinium has also been shown to be associated with increased fecundity in the predatory mite Metaseiulus occidentalis (Weeks and Stouthamer 2004). It would be highly interesting to assess the effects Cardinium has on its Dipteran (and other, e.g., spider) hosts.

Based on work on other symbionts, the consequences of infections can be extraordinarily varied and affect not only reproduction, but also immunity or non-reproductive behaviours. For example, Wolbachia infections can increase resistance to viruses in Aedes aegypti (Bian et al. 2010), and Rickettsia infection can hamper long-range dispersal behavior in a spider (Goodacre et al. 2009). Another area worthy of investigation is what happens when hosts harbor multiple infections (see Table 2). Co-infections with different strains of the same bacterium or different reproductive parasites are known to occur across arthropods (Weeks et al. 2003; Zchori-Fein and Perlman 2004; Goodacre et al. 2006; Gotoh et al. 2006; Duron et al. 2008a; Skaljac et al. 2010; Goodacre and Martin 2012). This problem has been the focus of theoretical (e.g., Engelstädter et al. 2008; Vautrin et al. 2008) and empirical study focusing specifically on interactions between Cardinium and the widespread Wolbachia (Gotoh et al. 2006; Ros and Breeuwer 2009; White et al. 2009; Sirviö and Pamilo 2010).

In conclusion, this is the first extensive survey specifically assessing possible infections with Cardinium in a wide selection of Diptera belonging to the empidoid families Dolichopodidae, Empididae, and Hybotidae (see Martin et al. 2013 for other symbionts). Although a large number of species tested positive for Cardinium in the PCR survey, only 10 of the 154 sequences analyzed could be assigned with certainty to Cardinium. These sequences stem from 10 species representing five subfamilies within the Dolichopodidae. We suggest that both the issues surrounding specificity of Cardinium primers (see Breeuwer et al. 2012) and the related question of how commonly this microbe might really infect arthopods in toto require further resolution. Finally, little is known of the effects this microbe has in Diptera, so possible impacts on its hosts and interactions with other endosymbionts in this speciose group are worthy of future study.

Table 1.

Overview of the number of infected species and genera as determined via PCR screens.

t01_01.gif

Table 2.

Overview of Cardinium sequences. Evidence for multiple infections when present data is combined with Martin et al. 2013. M. impigra and M. petrophiloides samples were also infected with Spiroplasma, M. saxatilis and Sciapus platypterus additionally harbored Wolbachia, whereas A. vestita and Chrysotus palustris were infected with both Spiroplasma and Rickettsia.

t02_01.gif

Acknowledgements

The authors would like to thank the Swiss National Science Foundation for support (Ambizione grants PZ00P3_121777 and PZ00P3137514; standard research grant 31003 A_125144/1 to O. Y. Martin and 31003A-115981/47191402 to M. V. Bernasconi), N. Puniamoorthy was supported by the National University of Singapore Overseas Graduate Scholarship (NUS-OGS). We also thank Marc Pollet (INBO Brussels) for providing fly samples, and Editor Michael Strand for valuable feedback.

References

  1. MV Bernasconi , M Pollet , M Varini-Ooijen , PI Ward. 2007a. Phylogeny of European Dolichopus and Gymnopternus (Diptera, Dolichopodidae) and the significance of morphological characters inferred from molecular data. European Journal of Entomology 104: 601–617. Google Scholar

  2. MV Bernasconi , M Pollet , PI Ward. 2007b. Molecular systematics of Dolichopodidae (Diptera) inferred from COI and 12S rDNA gene sequences based on European exemplars. Invertebrate Systematics 21: 453–470. Google Scholar

  3. DJ Bickel. 2009. 49. Dolichopodidae (LongLegged Flies). In: BV Brown , A Borkent , JM Cumming , DM Wood , NE Woodley , M Zumbado , Editors. Manual of Central American Diptera. pp. 671–694. National Research Council Canada. Google Scholar

  4. E Bigliardi , L Sacchi , M Genchi , A Alma , M Pajoro , D Daffonchio , M Marzorati , AM Avanzati. 2006. Ultrastructure of a novel Cardinium sp. symbiont in Scaphoideus titanus (Hemiptera: Cicadellidae). Tissue & Cell 38: 257–261. Google Scholar

  5. H Breeuwer , VID Ros , TVM Groot . 2012. Cardinium: The next addition to the family of reproductive parasites. In: E Zchori-Fein , K Bourtzis , Editors. Manipulative Tenants: Bacteria Associated with Arthropods. pp. 207–224. Taylor & Francis. Google Scholar

  6. D Bouchon , R Cordaux , P Grève . 2012. Rickettsiella, intracellular pathogens of arthropods. In: E Zchori-Fein , K Bourtzis , Editors. Manipulative Tenants: Bacteria Associated with Arthropods. pp. 127–148. Taylor & Francis. Google Scholar

  7. de Crespigny FEC Champion , N Wedell. 2006. Wolbachia infection reduces sperm competitive ability in an insect. Proceedings of the Royal Society of London B 273: 1455–1458. Google Scholar

  8. de Crespigny FEC Champion , TD Pitt , N Wedell. 2006. Increased male mating rate in Drosophila is associated with Wolbachia infection. Journal of Evolutionary Biology 19: 1964–1972. Google Scholar

  9. J Chang , A Masters , A Avery , JH Werren. 2010. A divergent Cardinium found in daddy long-legs (Arachnida: Opiliones). Journal of Invertebrate Pathology 105: 220–227. Google Scholar

  10. A Chigira , K Miura. 2005. Detection of ‘Candidates Cardinium’ bacteria from the haploid host Brevipalpus californicus (Acari: Tenuipalpidae) and effect on the host. Experimental and Applied Acarology 37: 107–116. Google Scholar

  11. ME Clark , CL Anderson , J Cande , TL Karr. 2005. Widespread prevalence of Wolbachia in laboratory stocks and the implications for Drosophila research. Genetics 170: 1667– 1675. Google Scholar

  12. DA D'Argenio , LA Gallagher , CA Berg , C Manoil. 2001. Drosophila as a model host for Pseudomonas aeruginosa infection. Journal of Bacteriology 183:1466–1471. Google Scholar

  13. O Duron , D Bouchon , S Boutin , L Bellamy , LQ Zhou , J Engelstädter , GDD Hurst. 2008a. The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biology 6: 27. Google Scholar

  14. O Duron , GDD Hurst , EA Hornett , JA Jostling , J Engelstädter. 2008b. High incidence of the maternally inherited bacterium Cardinium in spiders. Molecular Ecology 17: 1427–1437. Google Scholar

  15. J Engelstädter , GDD Hurst. 2009. The ecology and evolution of microbes that manipulate host reproduction. Annual Review of Ecology, Evolution, and Systematics 140: 127–149. Google Scholar

  16. J Engelstädter , A Telschow , N Yamamura. 2008. Coexistence of cytoplasmic incompatibility and male-killing-inducing endosymbionts, and their impact on host gene flow. Theoretical Population Biology 73: 125–133. Google Scholar

  17. M Enigl , P Schausberger. 2007. Incidence of the endosymbionts Wolbachia, Cardinium and Spiroplasma in phytoseiid mites and associated prey. Experimental and Applied Acarology 42: 75–85. Google Scholar

  18. C Germann , M Pollet , S Tanner , T Backeljau , MV Bernasconi. 2010. Legs of deception: disagreement between molecular markers and morphology of long legged flies (Diptera, Dolichopodidae). Journal of Zoological Systematics and Evolutionary Research 48: 238–247. Google Scholar

  19. C Germann , M Pollet , MV Bernasconi. 2011a. Aspects of European Argyra systematics: molecular insights and morphology (Diptera: Dolichopodidae). Entomologica Fennica 22: 5–14. Google Scholar

  20. C Germann , M Pollet , C Wimmer , MV Bernasconi. 2011b. Molecular data sheds light on the classification of long-legged flies (Diptera: Dolichopodidae). Invertebrate Systematics 25: 303–321. Google Scholar

  21. SL Goodacre , OY Martin. 2012. Modification of insect and arachnid behaviours by vertically acquired endosymbionts: infections as drivers of behavioural change and evolutionary novelty. Insects 3: 246–261. Google Scholar

  22. SL Goodacre , OY Martin , CFG Thomas , GM Hewitt. 2006. Wolbachia and other endosymbiont infections in spiders. Molecular Ecology 15: 517–527. Google Scholar

  23. SL Goodacre , OY Martin , D Bonte , L Hutchings , C Woolley , K Ibrahim , CFG Thomas , GM Hewitt. 2009. Microbial modification of host long-distance dispersal capacity. BMC Biology 7: 32. Google Scholar

  24. T Gotoh , H Noda , S Ito. 2006. Cardinium symbionts cause cytoplasmic incompatibility in spider mites. Heredity 98: 13–20. Google Scholar

  25. TVM Groot , JAJ Breeuwer. 2006. Cardinium symbionts induce haploid thelytoky in most clones of three closely related Brevipalpus species. Experimental and Applied Acarology 39:257–271. Google Scholar

  26. ME Gruwell , J Wu , BB Normark. 2009. Diversity and phylogeny of Cardinium (Bacteroidetes) in armored scale insects (Hemiptera: Diaspididae). Annals of the Entomological Society of America 102: 1050–1061. Google Scholar

  27. KJ Hackett , DE Lynn , DL Williamson , AS Ginsberg , RF Whitcomb. 1986. Cultivation of the Drosophila sex-ratio spiroplasma. Science 232: 1253–1255. Google Scholar

  28. K Hilgenboecker , P Hammerstein , P Schlattmann , A Telschow , JH Werren. 2008. How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiology Letters 281:215–220. Google Scholar

  29. MS Hunter , SJ Perlman , SE Kelly. 2003. A bacterial symbiont in the Bacteroidetes induces cytoplasmic incompatibility in the parasitoid wasp Encarsia pergandiella. Proceedings of the Royal Society of London B 270:2185–2190. Google Scholar

  30. TJ Kurtti , UG Munderloh , TG Andreadis , LA Magnarelli , TN Mather. 1996. Tick cell culture isolation of an intracellular prokaryote from the tick Ixodes scapularis. Journal of Invertebrate Pathology 67: 318–321. Google Scholar

  31. Y Liu , H Miao , XY Hong. 2006. Distribution of the endosymbiotic bacterium Cardinium in Chinese populations of the carmine spider mite Tetranychus cinnabarinus (Acari: Tetranychidae). Journal of Applied Entomology 130: 523–529. Google Scholar

  32. N Lo , C Paraskevopoulos , K Bourtzis , SL O'Neill , JH Werren , SR Bordenstein , C Bandi. 2007. Taxonomic status of the intracellular bacterium Wolbachiapipientis. International Journal of Systematic and Evolutionary Microbiology 57: 654–657. Google Scholar

  33. OY Martin , SL Goodacre. 2009. Widespread infections by the bacterial endosymbiont Cardinium in arachnids. Journal of Arachnology 37: 106–108. Google Scholar

  34. OY Martin , A Gubler , C Wimmer , C Germann , MV Bernasconi. 2012. Infections with Wolbachia and Spiroplasma in the Scathophagidae and other Muscoidea. Infection, Genetics and Evolution 12: 315–323. Google Scholar

  35. OY Martin , N Puniamoorthy , A Gubler , C Wimmer , MV Bernasconi. 2013. Infections with Wolbachia, Rickettsia and Spiroplasma in the Dolichopodidae and other Empidoidea. Infection, Genetics and Evolution 13: 317– 330. Google Scholar

  36. M Marzorati , A Alma , L Sacchi , M Pajoro , S Palermo , L Brusetti , N Raddadi , A Balloi , R Tedeschi , E Clementi , S Corona , F Quaglino , PA Bianco , T Beninati , C Bandi , D Daffonchio. 2006. A novel Bacteroidetes symbiont is localized in Scaphoideus titanus, the insect vector of flavescence dorée in Vitis vinifera. Applied and Environmental Microbiology 72 : 1467–1475. Google Scholar

  37. M Mateos , SJ Castrezana , BJ Nankivell , AM Estes , TA Markow , NA Moran. 2006. Heritable endosymbionts of Drosophila. Genetics 174: 363–376. Google Scholar

  38. Y Nakamura , S Kawai , F Yukuhiro , S Ito , T Gotoh , R Kisimoto , T Yanase , Y Matsumoto , D Kageyama , H Noda. 2009. Prevalence of Cardinium bacteria in planthoppers and spider mites and taxonomic revision of “Candidates Cardinium hertigii” based on detection of a new Cardinium group from biting midges. Applied and Environmental Microbiology 75 : 6757–6763. Google Scholar

  39. T Pape , D Bickel , R Meier. 2009. Diptera Diversity. Status, Challenges and Tools. Koninklijke Brill NV Google Scholar

  40. SJ Perlman , SA Magnus , CR Copley. 2010. Pervasive associations between Cybaeus spiders and the bacterial symbiont Cardinium. Journal of Invertebrate Pathology 103: 150–155. Google Scholar

  41. K Pfarr , J Foster , B Slatko , A Hoerauf , JA Eisen. 2007. On the taxonomic status of the intracellular bacterium Wolbachiapipientis: should this species name include the intracellular bacteria of filarial nematodes? International Journal of Systematic and Evolutionary Microbiology 57: 1677–1678. Google Scholar

  42. M Pollet. 2009. Diptera as ecological indicators of habitat and habitat change. In: T Pape , D Bickel , R Meier , Editors. Diptera Diversity: Status, Challenges and Tools , pp. 302–322. Koninklijke Brill NV Google Scholar

  43. M Pollet , SE Brooks. 2008. Long-legged flies (Diptera: Dolichopodidae). In: JL Capinera , Editor. Encyclopedia of Entomology. Volume 2. Second edition. pp. 2232–2241. Springer. Google Scholar

  44. M Pollet , C Germann , S Tanner , MV Bernasconi. 2010. Hypotheses from mitochondrial DNA: congruence and conflicts with morphology in Dolichopodinae systematics (Diptera: Dolichopodidae). Invertebrate Systematics 24: 32–50. Google Scholar

  45. M Pollet , C Germann , MV Bernasconi. 2011. Phylogenetic analyses using molecular markers reveal ecological lineages in Medetera (Diptera: Dolichopodidae). The Canadian Entomologist 143: 662–673. Google Scholar

  46. LM Provencher , GE Morse , AR Weeks , BB Normark. 2005. Parthenogenesis in the Aspidiotus nerii complex (Hemiptera: Diaspididae): A single origin of a worldwide, polyphagous lineage associated with Cardinium bacteria. Annals of the Entomological Society of America 98: 629–635. Google Scholar

  47. VID Ros , JAJ Breeuwer. 2009. The effects of, and interactions between, Cardinium and Wolbachia in the doubly infected spider mite Bryobia sarothamni. Heredity 102: 413–422. Google Scholar

  48. A Sirviö , P Pamilo. 2010. Multiple endosymbionts in populations of the ant Formica cinerea. BMC Evolutionary Biology 10: 335. Google Scholar

  49. M Skaljac , K Zanic , SG Ban , S Kontsedalov , M Ghanim. 2010. Co-infection and localization of secondary symbionts in two whitefly species. BMC Microbiology 10: 142. Google Scholar

  50. H Ulrich. 2004. Predation by adult Dolichopodidae (Diptera): a review of literature with an annotated prey-predator list. Studia dipterologica 11: 369–403. Google Scholar

  51. E Vautrin , S Genieys , S Charles , F Vavre. 2008. Do vertically-transmitted symbionts coexisting in a single host compete or cooperate? A modelling approach. Journal of Evolutionary Biology 21: 145–161. Google Scholar

  52. AR Weeks , R Stouthamer . 2004. Increased fecundity associated with infection by a Cytophaga-like intracellular bacterium in the predatory mite, Metaseiulus occidentalis. Proceedings of the Royal Society of London B (Supplement) 271: S193–S195. Google Scholar

  53. AR Weeks , F Marec , JA Breeuwer. 2001. A mite species that consists entirely of haploid females. Science 292: 2479–2482. Google Scholar

  54. AR Weeks , R Velten , R Stouthamer. 2003. Incidence of a new sex-ratio-distorting endosymbiotic bacterium among arthropods. Proceedings of the Royal Society of London B 270: 1857–1865. Google Scholar

  55. LA Weinert , MC Tinsley , M Temperley , FM Jiggins. 2007. Are we underestimating the diversity and incidence of insect bacterial symbionts? A case study in ladybird beetles. Biology Letters 3: 678–681. Google Scholar

  56. JA White , SE Kelly , SJ Perlman , MS Hunter. 2009. Cytoplasmic incompatibility in the parasitic wasp Encarsia inaron: disentangling the roles of Cardinium and Wolbachia symbionts. Heredity 102: 483–489. Google Scholar

  57. R Xie , L Zhou , Z Zhao , X Hong 2010. Male age influences the strength of Cardiniuminduced cytoplasmic incompatibility expression in the carmine spider mite Tetranychus cinnabarinus. Applied Entomology and Zoology 45: 417–423. Google Scholar

  58. JH Yen , AR Barr. 1971. New hypothesis of the cause of cytoplasmic incompatibility in Culex pipiens. Nature 232: 657–658. Google Scholar

  59. E Zchori-Fein , SJ Perlman. 2004. Distribution of the bacterial symbiont Cardinium in arthropods. Molecular Ecology 13: 2009–2016. Google Scholar

  60. E Zchori-Fein , Y Gottlieb , SE Kelly , JK Brown , JM Wilson , TL Karr , MS Hunter. 2001. A newly discovered bacterium associated with parthenogenesis and a change in host selection behavior in parasitoid wasps. Proceedings of the National Academy of Sciences USA 98: 12555–12560. Google Scholar

  61. E Zchori-Fein , SJ Perlman , SE Kelly , N Katzir , MS Hunter. 2004. Characterization of a ‘Bacteroidetes’symbiont in Encarsia wasps (Hymenoptera: Aphelinidae): proposal of ‘Candidates Cardinium hertigii’. International Journal of Systematic and Evolutionary Microbiology 54: 961–968. Google Scholar

This is an open access paper. We use the Creative Commons Attribution 3.0 license that permits unrestricted use, provided that the paper is properly attributed.
Oliver Y. Martin, Nalini Puniamoorthy, Andrea Gubler, Corinne Wimmer, Christoph Germann, and Marco V. Bernasconi "Infections with the Microbe Cardinium in the Dolichopodidae and Other Empidoidea," Journal of Insect Science 13(47), 1-13, (1 June 2013). https://doi.org/10.1673/031.013.4701
Received: 9 January 2012; Accepted: 1 September 2012; Published: 1 June 2013
JOURNAL ARTICLE
13 PAGES


SHARE
ARTICLE IMPACT
Back to Top