INTRODUCTION

Studies on the geographic distribution of parasitic species are fundamental for understanding their circulation in the natural environment and for an assessment of endemic regions. In the case of parasites with zoonotic potential, knowledge on the distribution of a particular species is furthermore important for determining the potential risk for humans. Food-borne transmission of causative agents of parasitic zoonoses is considered to be one of the most frequent paths of infection. A special category of food-borne diseases are fish-borne parasitic zoonoses, characterized by their transmission via freshwater, brackish or marine fish.

Diphyllobothriosis, caused by so-called “broad tapeworms” or “fish tapeworms” of different genera of the order Diphyllobothriidea, is a significant fish-borne parasitic zoonosis responsible for about 20 million human infections worldwide (Chai et al., 2005). One of the most common causative agents of human diphyllobothriosis is the broad fish tapeworm Dibothriocephalus latus (Linnaeus, 1758) (Cestoda: Diphyllobothriidea), previously known under the scientific name Diphyllobothrium latum. Recent phylogenetic study of the order Diphyllobothriidea divided the polyphyletic genus Diphyllobothrium into two, Diphyllobothrium and the resurrected Dibothriocephalus (Waeschenbach et al., 2017) comprising seven species with D. latus as the type species.

The complex life cycle of this tapeworm involves two intermediate hosts (crustaceans and fish) and a definitive host (fish-eating mammals, including humans). Humans, probably the main definitive host maintaining the life cycle of the parasite (Golay & Mariaux, 1995), can be infected by the consumption of raw or undercooked fish fillets containing infective larval stages, plerocercoids. Diphyllobothriosis has been associated with eating habits, such as the consumption of salted or marinated fish fillets in the Baltic or Scandinavian countries and local raw fish specialities in the Alpine region (Switzerland, France and northern Italy), which represents the area with frequent or relatively frequent occurrence of diphyllobothriosis in humans (Golay & Mariaux, 1995; Desvois et al., 2001; Peduzzi & Boucher-Rodoni, 2001; Terramocci et al., 2001; Dupouy-Camet & Peduzzi, 2004; Yera et al., 2008; Wicht et al., 2010a, b). Infections in humans can be either autochthonous, or D. latus can be acquired during trips or stays abroad (imported cases). On the other hand, the direct detection of plerocercoids in the second intermediate fish host reflects the occurrence of the parasite in a particular natural environment. In Europe, the European perch (Perca fluviatilis) is the most suitable host of D. latus, while the Northern pike (Esox lucius) serves as a common paratenic host, and the burbot (Lota lota) plays a less important role in transmitting D. latus to humans (Gustinelli et al., 2016). The occurrence of D. latus in fish has been frequently detected in lakes of the Alpine region, including northern Italy (Gustinelli et al., 2016), Switzerland and France (Dupouy-Camet et al., 2015). Moreover, regular detection of D. latus plerocercoids in fish was also confirmed in Russia (Klebanowski, 1985; Novak, 2012; Dugarov & Pronin, 2017), the Baltic region, in particular Estonia (Jõgiste & Barotov, 1993; Wicht et al., 2010a, b), and Fennoscandia, including Finland (Andersen & Valtonen, 1992; Valtonen & Julkunen, 1995; Valtonen et al., 1997), Norway (Vik, 1957) and Sweden (Akuffo et al., 2003).

The Alpine region represents an important area from a medical and epidemiological point of view due to local eating habits and the relatively frequent detection of D. latus infection in humans. The rather constant prevalence and regular detection of D. latus plerocercoids in fish also make this region very interesting from an ecological point of view. The aim of this study was to provide the latest data on the occurrence of D. latus plerocercoids in European perch from different Alpine lakes to reveal the current situation of D. latus occurrence and to compare it with previously published data.

Fig. 1.

Schematic representation of sampling sites of Dibothriocephalus latus from European perch (Perca fluviatilis) from the Alpine lakes region. (1) Lake Geneva; (2) Lake Neuchâtel; (3) Lake Biel; (4) Lake Maggiore; (5) Lake Como; (6) Lake Iseo. FR, France; CH, Switzerland; IT, Italy. Maps obtained from d-maps.com.

MATERIAL AND METHODS

A total of 688 European perch (Perca fluviatilis) originating from six Alpine lakes (Fig. 1) were examined for D. latus plerocercoids. Out of them, 156 fish originated from Lake Geneva (Switzerland/France), 50 from Lake Neuchâtel (Switzerland), 8 from Lake Biel (Switzerland), 46 from Lake Como (Italy), 48 from Lake Maggiore (Italy/Switzerland) and 380 from Lake Iseo (Italy). The examinations were carried out in March 2017 (Lakes Como, Maggiore and Iseo), May 2018 (Lake Iseo) and June 2018 (Lakes Geneva, Neuchâtel and Biel). The fish were caught by professional fishermen using gill nets and kept on ice until they were dissected. Fish were examined by parasitological necropsy focused on musculature and the peritoneal cavity (intestine, liver and other abdominal organs). In order to detect the presence of D. latus larvae in muscles, thin (approximately 5 mm) slices of fillets of whole fish were carefully examined by direct observation. The parasites found in host tissues were isolated by means of dissecting needles, checked under a stereomicroscope, placed in 0.9% NaCl solution and finally fixed in 96% molecular-grade ethanol for further molecular analyses.

For molecular genotyping of plerocercoids, genomic DNA of all individuals was isolated using the QIAamp® DNA Mini Kit (QIAGEN, Hilden, Germany) following the instructions of the manufacturer. D. latus-specific PCR was performed with the forward MulLat3 (GGGGTGTTACGGGTATTATACTC) and reverse MulRevCom (ATGATAAGGGAYAGGRGCYCA) primers designed for amplification of a partial (437 bp) fragment of mitochondrial cytochrome c oxidase subunit 1 (cox1 mt DNA), according to Wicht et al. (2010b). The PCR products were visualized on 1.5% agarose gel and purified using exonuclease I and shrimp alkaline phosphatase (Werle et al., 1994). Sequencing was performed using the automatic genetic analyzer Applied Biosystems 3130xl (Applied Biosystems, Foster City, California, USA) and the BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems). Contiguous sequences were assembled and inspected for errors using Geneious (version 10.0.5, Biomatters, Auckland, New Zealand). The newly obtained cox1 sequences were compared with respective sequences of D. latus available in the GenBank ( https://www.ncbi.nlm.nih.gov/genbank/).

RESULTS

Table 1 summarizes data on the fish examined and the prevalence detected in each particular lake. The lowest prevalence (2%) was detected in Lake Neuchâtel. The highest prevalence (37.5%) was observed in Lake Biel; however, this could be influenced by the rather low number (no = 8) of fish examined. As for the other four lakes, the prevalence varied from 6.4% (Lake Geneva) up to 22.8% (Lake Iseo; 2018). The prevalence was mostly in the range of 10-20%, in particular 12.8% (Lake Iseo; 2017), 15.2% (Lake Como) and 16.7% (Lake Maggiore). Each fish was mainly infected by a single plerocercoid in the musculature, predominantly in dorsal muscles. In Lake Geneva, three fish were infected with two larvae and one perch harboured five plerocercoids.

Altogether, 108 plerocercoids were obtained from 688 European perch from the six studied Alpine lakes; all of them were subjected to molecular genotyping. Sequences of a 430 bp mitochondrial cox1 fragment of all individuals were 100% identical, and no intraspecific genetic diversity was observed. Comparison of the newly obtained data with the sequences deposited in the GenBank revealed 100% identity with D. latus from European perch from Switzerland (GenBank Accession numbers FM209180-1, GU997614, AY972071, DQ768197) and Italy (GU997613, KU341699, KU341702, KU341709, KU341711-2, KU341716), as well as with D. latus from Northern pike (KU341707 and KU341714) and burbot (KU341705) from Italy.

DISCUSSION

Current data on the occurrence of D. latus in perch from Lakes Como, Iseo, Maggiore, Geneva, Biel and Neuchâtel confirmed the presence of this medically important causative agent of diphyllobothriosis in the Alpine region, corresponding well to previously published results (Bouvier et al., 1963; Golay & Mariaux, 1995; Peduzzi & Boucher-Rodoni, 2001; Dupouy-Camet & Peduzzi, 2004; Nicolaud et al., 2005; Wicht et al., 2009a, b; Prearo et al., 2013; Dupouy-Camet & Yera, 2015; Dupouy-Camet et al., 2015; Gustinelli et al., 2016). These surveys were predominantly focused on examinations of European perch, the most suitable host of D. latus (Table 1). Hence, the data provided in the current paper were based only on examinations of perch, and no other fish species were investigated.

As has been observed previously, the majority of plerocercoids collected from perch were found in fillets, while only a few of them were collected from the serosa (Gustinelli et al., 2016). The location of plerocercoids in the visceral cavity also depends on the size of the perch. According to the personal experience of one co-author (A. Gustinelli), perch of larger size can ingest smaller infected perch, thus becoming a paratenic host, similarly to burbot and pike. In the current study, all plerocercoids were found in perch fillets; no larvae were detected in the peritoneal cavity or internal organs. The length of the perch examined ranged between 100-300 mm; however, most of the fish were around 150 mm in length, which may explain the absence of plerocercoids in the serosa.

Most studies on D. latus prevalence in fish have focused on Lake Geneva, shared between Switzerland and France, where the prevalence of D. latus in perch ranged between 4.0-29.2% (Dupouy-Camet & Peduzzi, 2004; Nicolaud et al., 2005; Wicht et al., 2009b; Dupouy-Camet & Yera, 2015; Dupouy-Camet et al., 2015). In contrast, the oldest data on the prevalence of D. latus in fish in Lake Geneva provided significantly higher values, in particular 95% in burbot and 58% in perch (Ketchekian, 1909 cited in Bouvier et al., 1963). These findings indicated the specific dynamics of the occurrence of D. latus in the Alpine region. Diphyllobothriosis caused by D. latus was a widespread fish-borne zoonosis at the beginning of the past century; however, it virtually disappeared later on (Gustinelli et al., 2016). Since the early 1980s, especially after year 2000, diphyllobothriosis has shown a comeback in some subalpine areas, particularly on the shores of the great subalpine lakes (Wicht et al., 2009a, b).

Currently, the detected prevalence of D. latus in perch from Lake Geneva was 6.4%, which fits into the most frequent and previously published values (4.0-12.0%) (Table 1). A rather high prevalence (22.2-28.6%) has been detected in burbot, and even a 100% prevalence was documented in pike (Dupouy-Camet & Yera, 2015; Dupouy-Camet et al., 2015). In general, pike seems to be the host with the highest detected prevalence of D. latus, with 12.5% in Lake Morat and 14.3% in Lake Biel, up to very high values of 71.4% (Lake Iseo), 84.2% (Lake Como) and 100% in Lakes Maggiore and Geneva (see Table 1 for references).

In the current study, the detected prevalence of D. latus in perch from Lake Como was the lowest (15.2%) when compared with previously reported data (Table 1). In three other lakes (Iseo, Maggiore and Biel), the prevalence in perch revealed the highest values in comparison with previous data (Table 1). Since only eight fish were currently examined in Lake Biel, and a different sample size of examined fish was analysed in the present work and previously published surveys, it is difficult to compare data on prevalence and make reliable conclusions.

Table 1.

Summary of literature data and current results of prevalence of Dibothriocephalus latus plerocercoids in European perch (Perca fluviatilis), pike (Esox lucius) and burbot (Lota lota) from the Alpine lakes in Italy (Lakes Como and Iseo), Italy/ Switzerland (Lake Maggiore), Switzerland/France (Lake Geneva) and Switzerland (Lakes Biel, Morat and Neuchâtel).

Besides the Alpine lakes, the presence of D. latus has also been confirmed in fish in Russia, the Baltic region, and Fennoscandia (see the above references in the Introduction). However, diphyllobothriosis seems to be strongly reduced or even to have disappeared in many of these localities (Scholz & Kuchta, 2016), which may have several explanations. In the past, D. latus occurred in a particular locality, but due to some environmental/ biological changes preventing the maintenance of the parasite life cycle, it has disappeared from the region. Another explanation for the lack of data on D. latus occurrence in previously endemic areas, such as the Baltic region and Fennoscandia, are altered eating habits of humans, resulting in a decrease of diphyllobothriosis to the point that it is no longer a serious medical problem. As a consequence, physicians and parasitologists can pay lower attention to this parasitosis.

In the subalpine territory, humans seem to be the most suitable host of D. latus (Wicht et al., 2009b) and probably serve as the only definitive host maintaining the life cycle of the parasite (Golay & Mariaux, 1995). Wild or domesticated carnivores may play only a minor role in the continuation of the cycle (Dupouy-Camet & Peduzzi, 2004). Although knowledge on the ecology and epidemiology of helminths shared by wild carnivores in Europe is limited, wild felids can contribute to environmental contamination and maintenance of the life cycle of D. latus (Otranto et al., 2015; Zottler et al., 2019). However, the latest examination of 168 stray cats in different regions in Switzerland revealed the presence of D. latus eggs only in one faecal sample (Zottler et al., 2019).

The presence of D. latus in perch in Alpine lakes is of great importance from a public health perspective, as the increasing popularity of raw fish dishes is thought to be linked to the re-emergence of human diphyllobothriosis in the subalpine area (Wicht et al., 2009b). Plerocercoids may survive in perch from several months up to a few years (Dick et al., 2001; Dick, 2007), and since they mainly prefer dorsal muscles (Prearo et al., 2013), they can be easily missed during food preparation (Jackson et al., 2007). Therefore, it is not surprising that human diphyllobothriosis in the Alpine lakes has corresponded to the infection of perch with D. latus plerocercoids (Wicht et al., 2007), and the subalpine area has been the site of several episodes of human infections (Gustinelli et al., 2016). Ineffective sewage treatment systems, which lead to the contamination of lakes by cestode eggs shed by infected humans, is the second main risk factor for the persistence of diphyllobothriosis in subalpine lakes (Gustinelli et al., 2016). In addition, faecal pollution of lakes by professional and leisure fishing on and around lakes can also be considered as one of the important factors in the continuation of the life cycle (Dupouy-Camet & Peduzzi, 2004). Therefore, preventive measures, sanitary precautions and healthcare education concerning safe raw fish preparation have been permanently important and should also continue in future.

Ongoing epidemiological and ecological monitoring of diphyllobothriosis in the Alpine region has provided the latest data and dynamics on the occurrence of this fish-borne zoonosis. As for other European regions, up-to-date surveys are necessary for accurate knowledge on human diphyllobothriosis and the circulation of D. latus in the natural environment. Special attention should be paid to localities with previous findings of the tapeworm based only on morphology. Modern differentiation techniques and the latest knowledge on ecology and distribution of D. latus should be applied in future studies on this medically important and biologically interesting tapeworm.