Trees that belong to the family Lecythidaceae are often used as indicators of disturbance in lowland tropical forests, in particular because they are usually among the most common trees in these rich but fragile ecosystems (Mori et al., 2007). In addition to their ecological significance, some species may also be economically important, such as the Brazil nut tree Bertholletia excelsa Bonpl. For these reasons, polymorphic genetic markers have been developed for several species of several subfamilies of Lecythidaceae, mostly in taxa occurring as large trees in the Amazon Basin (e.g., Bertholletia Bonpl. [Reis et al., 2009], Cariniam Casar. [Guidugli et al., 2009, 2010], and Lecythis Loefl. [Rodrigues et al., 2015]), but also in a few other taxa found in the Old World (e.g., Barringtonia J. R. Forst. & G. Forst. [Xie et al., 2015]). However, to our knowledge, polymorphic markers are not yet available for the representatives of Lecythidaceae in the biodiversity hotspot formed by Madagascar and the Indian Ocean islands.
Out of 18 species that make up the genus Foetidia Comm, ex Lam. (subfamily Foetidioideae), 17 are endemic to island biotas in Madagascar, the Comoros, and the Mascarene Islands, while one species is found only on the African continent in Tanzania (Prance, 2008; Labat et al., 2011). The endemic species F. mauritiana Lam. was common in drier areas of Mauritius and Réunion where precipitation is low and temperatures are high, relative to the wet conditions generally found on these two tropical islands. However, for this species as for many indigenous taxa adapted to dry tropical habitats, populations have undergone rapid decline in less than 400 years since human settlement, and those few remaining stands are left in highly fragmented landscapes on both islands. This species is considered endangered in Réunion and Mauritius. There is an urgent need to protect and restore natural communities in tropical dry habitats on the Indian Ocean islands as well as worldwide (Miles et al., 2006). A European Union–supported project, Life+ Corexrun, was launched in 2009 on Réunion; it aims at both reintroducing 48 indigenous plant species (including F. mauritiana) and controlling invasions by alien plants within and around semi-dry forest stands.
METHODS AND RESULTS
Genomic DNA of F. mauritiana was extracted with the DNeasy Plant Mini Kit (QIAGEN, Hilden, North Rhine-Westphalia, Germany). Production of a microsatellite-enriched library was outsourced to the high-throughput platform set up by Genoscreen (Lille, Nord-Pas-de-Calais-Picardie, France). Following the method described in Malausa et al. (2011), 1 µg of genomic DNA was mechanically fragmented, ligated to standard adapters (Adap-F: GTTTAAGGCCTAGCTAGCAGAATC and Adap-R: GATTCTGCTAGCTAGGCCTT), and enriched by addition of eight biotin-labeled oligoprobes corresponding to the following microsatellite motifs: (TG)n, (TC)n, (AAC)n, (AAG)n, (AGG)n, (ACG)n, (ACAT)n, and (ACTC)n. Enriched DNA was isolated using Dynabeads (Invitrogen, Waltham, Massachusetts, USA) and amplified by PCR with primers corresponding to the library adapters (PCR protocol not communicated by Genoscreen). Sequencing was carried out through 454 GS-FLX Titanium pyrosequencing (Roche Applied Science, Penzberg, Bavaria, Germany). Sequences were analyzed using the bioinformatics program QDD (Meglécz et al., 2010), which detects microsatellite sequences and designs primers in flanking regions. We then selected 13 primer pairs among the microsatellite sequences (dinucleotide repeats), because they had adequate flanking regions for designing primers (see Table 1 for locus information, primers, and GenBank accession numbers). Eight additional microsatellite loci are provided in this paper, although population testing was not conducted for these markers (Appendix 1).
Table 1.
Characteristics of 13 microsatellite loci developed in Foetidia mauritiana.
![t01_01.gif](ContentImages/Journals/apps/4/8/apps.1600034/graphic/WebImages/t01_01.gif)
For biological validation, we selected the main wild populations on Réunion. This included 49 individuals sampled near the Lataniers River (mean elevation 330 m), 45 individuals on the southern slope of the Grande-Chaloupe River (545 m), and 27 individuals near the Tamarins River (270 m), for a total of 121 individuals (sampling authorized by the Parc National de La Réunion, the Office National des Forêts, the Département de La Réunion, and the Conservatoire du Littoral). Because the species is considered critically endangered on Réunion, we harvested no more than 1–2 leaves per individual tree, with the exception of three individuals (one per locality) from which voucher specimens were made (see Appendix 2). Plant genomic DNA was isolated with the DNeasy Plant Mini Kit (QIAGEN). Multiplex PCR was performed in a total volume of 15 µL containing 7.5 µL 2× Type-it Multiplex PCR Master Mix (QIAGEN), 1.5 µL 5× Q-Solution, 0.2 µM each primer, and 20–50 ng template DNA. The thermal cycling protocol was as follows: initial denaturation at 95°C for 5 min; 28 cycles of denaturation at 95°C for 30 s, primer annealing at 57°C for 90 s, extension at 72°C for 30 s; and final extension at 60°C for 30 min. PCR products were diluted in HPLC-grade water (1:10), denatured in formamide, and separated on a 16-capillary ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems, Foster City, California, USA); GeneScan 500 LIZ (Applied Biosystems) was used for sizing alleles in the expected range of 80–300 bp.
Table 2.
Genetic properties of the 13 newly developed microsatellites of Foetidia mauritiana.a
![t02_01.gif](ContentImages/Journals/apps/4/8/apps.1600034/graphic/WebImages/t02_01.gif)
Allele sizes were estimated using the Microsatellite Plugin version 1.4 implemented in Geneious version 8.1.7 (Biomatters, Auckland, New Zealand). The number of different alleles and observed and expected heterozygosity were calculated for each locus and population in GenAlEx (Peakall and Smouse, 2006, 2012). Hardy–Weinberg exact tests (9999 iterations) and linkage disequilibrium were analyzed in GENEPOP version 4.2 (Rousset, 2008). The presence of null alleles was estimated with MICRO-CHECKER version 2.2.3 (van Oosterhout et al., 2004). The minimum number of microsatellite loci necessary to discriminate individuals of F. mauritiana was assessed using the package poppr in R software (Kamvar et al., 2015).
Table 3.
Cross-species amplification (showing number of different alleles and size range) of the 13 newly developed microsatellites of Foetidia mauritiana.a
![t03_01.gif](ContentImages/Journals/apps/4/8/apps.1600034/graphic/WebImages/t03_01.gif)
All microsatellite loci revealed polymorphisms in F. mauritiana populations on Réunion. The number of different alleles per locus ranged from two to 17 (Table 2). Four loci showed significant deviation from Hardy–Weinberg equilibrium: FmCIR27, FmCIR47, FmCIR16, and FmCIR3. No significant linkage disequilibrium was detected between pairs of loci. We found that the minimum number of loci necessary to discriminate individuals in the data set was eight (data not shown).
Transferability of the microsatellite loci was tested on 28 individuals of F. mauritiana and 30 individuals of F. rodriguesiana F. Friedmann sampled across Mauritius and Rodrigues, respectively (sampling authorized by the National Parks and Conservation Service of Mauritius). Conspecific populations on different islands were tested because they are expected to experience strong genetic isolation. Foetidia rodriguesiana is morphologically similar to F. mauritiana (Prance, 2008). Using the above-mentioned protocol, we found that all loci amplified in Foetidia populations found on other islands, with the exception of FmCIR31, which did not amplify in F. rodriguesiana (Table 3). Moreover, most loci were polymorphic in the Mauritius and Rodrigues populations.
CONCLUSIONS
We developed 13 polymorphic genetic markers for Foetidia, a widespread genus in the Indian Ocean islands biodiversity hotspot. They will aid in designing priority populations for conservation and implementing adaptive conservation plans for the genus. They may also be used to study mating systems and pollen and seed flow between lowland forest fragments.
ACKNOWLEDGMENTS
The authors thank S. Dafreville, T. M'sa, and J. Segrestin (laboratory assistance); P. Adolphe, S. Baret, L. Calichiama, M. Félicité, R. Lucas, H. Thomas (assistance on Réunion); and J. T. Genave, R. Parmananda, J.-C. Sevathian, and A. Waterstone (assistance on Mauritius and Rodrigues). This work was funded by the European Regional Development Fund (ERDF), by the Région Réunion, and by the Centre de Coopération International en Recherche Agronomique pour le Développement (CIRAD).