Oocyte Recovery, CHX Treatment, and In Vitro Maturation of Oocytes

Ovine ovaries were collected from a local slaughter house and transported to the laboratory within 3 h in warm (30–35°C) PBS (160 mM NaCl, 3 mM KCl, 8 mM Na₂HPO₄, and 1 mM KH₂PO₄). Medium-sized (2–4 mm) follicles were aspirated using a needle and syringe. To the treatment group, CHX was added (final concentration, 5 μg/ml) to the follicular fluid during the aspiration process. Cumulus-oocyte complexes (COCs) with at least two layers of cumulus cells were selected for maturation using in vitro maturation (IVM) medium (bicarbonate-buffered M199 medium [Gibco] supplemented with 10% heat-inactivated fetal bovine serum [FBS], 0.05 U/ml of follicle-stimulating hormone/luteinizing hormone [Pluset], 1.0 μg/ml of 17β-estradiol, 50 μg/ml of gentamicin, 0.9 mM sodium pyruvate, and 0.1 mM cysteamine). For the treatment group, 5 μg/ml of CHX were added to the IVM medium. COCs were incubated in a humidified incubator at 39°C and 5% CO₂ in air. After the treatment period, COCs were washed three times in HEPES-buffered M199 and once in IVM medium and then matured in the same way as the control group. Cumulus expansion was assessed by measuring the area of COCs photographed before and after maturation using the SimplePCI software (Digital Pixel).

Assessment of Nuclear Maturation

Aceto-Orcein staining was carried out to determine the meiotic stages of oocytes. Cumulus cells were removed, and denuded oocytes were fixed in one part acetic acid and three parts ethanol for at least 24 h at room temperature. Fixed oocytes were stained in Aceto-Orcein stain solution (1% orcein and 45% acetic acid) for 10 min at room temperature. Oocytes were mounted and slides observed under phase-contrast microscopy at 1000× magnification.

IVF, Parthenogenesis, and Somatic Cell Nuclear Transfer

For IVF, a frozen ram semen pellet was thawed and incubated in capacitation medium (0.33 mM sodium pyruvate, 1.0 mM l-glutamine, 4.0 mM sodium bicarbonate, 21 mM HEPES, 3.35 mM sodium lactate, 108 mM sodium chloride, 7.2 mM potassium chloride, 1.2 mM potassium phosphate monobasic, 1.7 mM calcium chloride, 0.49 mM magnesium chloride, 2.4 mM glucose, 0.23 mM phenol red, 50 U/ml of penicillin, and 50 ng/ml of streptomycin; pH 7.4 and 270–290 mOsm) for 1 h at 39°C. Motile sperm were collected from the supernatant, centrifuged at 850 × g for 10 min at room temperature, and resuspended in a small volume of IVF medium (2% FBS, 1.0 mM sodium pyruvate, 1.0 mM l-glutamine, 25 mM sodium bicarbonate, 10 mM sodium lactate, 108 mM sodium chloride, 7.2 mM potassium chloride, 1.2 mM potassium phosphate monobasic, 3.4 mM calcium chloride, 0.49 mM magnesium chloride, 1.4 mM phenol red, 50 U/ml of penicillin, and 50 ng/ml of streptomycin; pH 7.9 and 270–290 mOsm). Matured COCs were incubated with 5 000 000 sperm/ml in IVF medium for 20 h in a humidified incubator at 39°C and 5% CO₂ in air. Presumptive zygotes were rinsed and cultured at 39°C with 5% CO₂ and 5% O₂ in synthetic oviduct fluid (SOF; 7.3 mM sodium pyruvate, 0.20 mM l-glutamine, 25 mM sodium bicarbonate, 5.4 mM sodium lactate [syrup], 108 mM sodium chloride, 7.2 mM potassium chloride, 1.2 mM potassium phosphate monobasic, 1.8 mM calcium chloride, 1.5 mM magnesium chloride, 0.34 mM trisodium citrate, 2.8 mM myo-inositol, 10 μg/ml of phenol red, 0.1 mM essential and nonessential amino acids, and 4 mg/ml of free-fatty-acids bovine serum albumin; pH 7.4 and 270–290 mOsm). Culture medium was changed at Day 3.

Somatic cell nuclear transfer (SCNT) was carried out as previously described [27] with minor modifications. Briefly, COCs were denuded of cumulus cells at 14 h postmaturation (hpm) by treatment with hyaluronidase (0.9 mg/ml; Sigma) combined with repeated, gentle pipetting. Oocytes with extruding spindles at anaphase I/telophase I (AI/TI) were selected for enucleation. AI/TI oocytes were briefly incubated in 10 μg/ml of Hoechst 33342 and 7.5 μg/ml of cytochalasin B (Sigma) in IVM medium, and enucleations were carried out in calcium-free, HEPES-buffered SOF (hSOF) with 7.5 μg/ml of cytochalasin B using a micromanipulator. Enucleated oocytes were returned to IVM containing 10 mM caffeine for 6 h until cell transfer. Fetal fibroblast donor cells were synchronized in G₀ by serum starvation for at least 2 days before SCNT. One cell was transferred into the perivitelline space of each enucleated oocyte and fused with one AC pulse of 1 V for 5 sec and two DC pulses of 100 V for 15 μsec each in fusion medium (0.3 M mannitol and 0.1 mM magnesium sulfate; 280 mOsm). Reconstructed embryos were further cultured in IVM medium for 2 h to allow nuclear envelope breakdown of the donor nucleus. Embryos were then activated at 25–27 hpm in hSOF containing 5 μM calcium ionophore (A23187) and calcium ions for 5 min, then rinsed and incubated with 10 μg/ml of CHX and 7.5 μg/ml of cytochalasin B in SOF for 5 h at 39°C with 5% CO₂ and 5% O₂. Oocytes were then thoroughly rinsed and incubated in SOF.

For parthenogenesis, COCs were denuded from cumulus cells at 24 hpm and then activated as described for SCNT.

Western Blot Analysis

Oocytes were completely denuded of cumulus cells, thoroughly rinsed in PBS, and stored at −80°C in 2 μl of PBS until use. Oocytes were lysed by adding one volume of 2× Laemmli buffer (Bio-Rad Laboratories) supplemented with phosphatase inhibitors (5 mM sodium fluoride, 2 mM sodium vanadate, and 2 mM β-glycerophosphate), vortexed, and heated at 95°C for 10 min. Samples were loaded into a denaturing polyacrylamide gel (SDS-PAGE) with lanes of 1.5 mm in width. Protein samples were electrophoresed at 150 V for 70 min, and resolved proteins were transferred onto a polyvinylidene fluoride membrane (Bio-Rad Laboratories) at 70 V for 3 h in transfer buffer (25 mM Tris, 192 mM glycine, and 20% methanol; pH 8.3). After transfer, membranes were blocked in 5% nonfat milk in PBS supplemented with 0.1% Tween 20 (PBS-T) for 1 h at room temperature, followed by overnight incubation at 4°C with primary antibody rabbit anti-CCNB1 (1:1000; C-8831; Sigma) in blocking buffer. After several washes in PBS-T, membranes were incubated with secondary antibody enhanced chemiluminescence (ECL) anti-rabbit immunoglobulin G conjugated to horseradish peroxidase (HRP; 1:30 000; NA934; Amersham Biosciences, GE Healthcare) in blocking buffer for 1 h at room temperature. The membrane was then washed six times for 5 min each time with PBS-T and treated with Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare). The chemiluminescence signal was developed with Hyperfilms ECL (Amersham). After washing, membranes were reprobed with rabbit anti-phospho-p44/42 MAPK antibody (1:2000; 9101; Cell Signaling Technology) in blocking buffer with a 2-h incubation at room temperature. Following signal detection, membranes were reprobed for the housekeeping protein α-tubulin using mouse monoclonal antibody anti-tubulin (1:2000; T5168; Sigma), followed by anti-mouse secondary antibody conjugated to HRP (1:10 000; SA1-100; Thermo Scientific) in blocking buffer. For total MAPK, membranes were stripped mildly, blocked, and incubated with anti-ERK1/2 antibody (1:2000; 9102; Cell Signaling Technology). Densitometric analysis of blots was carried out with ImageJ software (National Institutes of Health).

RNA-Ligation Polyadenylation Test

The RNA-ligation polyadenylation assay was used to compare the relative length of the poly(A) tail as previously described [28]. Briefly, total RNA was extracted from 30–50 oocytes using the Absolutely RNA Nanoprep kit (Agilent Technologies) and treated with DNase following the manufacturer's instructions. A modified anchor oligo (5′-P-GGTCACCTTGATCTGAAGC-NH₂-3′) was ligated to total RNA followed by cDNA synthesis with SuperScript III Reverse Transcriptase (Invitrogen) using the PAT-R1 primer (5′-GCTTCAGATCAAGGTGACCTTTTT-3′). The QIAGEN Fast Cycling PCR Kit (Qiagen) was used to amplify target cDNA in 40 cycles of 96°C for 10 sec, 62°C for 10 sec, and 68°C for 30 sec using the PAT-R1 reverse primer and the following forward gene specific primers (5′ to 3′): CCNB1, ggctgtggcaaaggtgtaac; MOS, ctctatgccgtggtggccta; and GDF9 (growth differentiation factor 9), gtcctggccagtgtaaatgc. PCR products were resolved in 1.5%–3% agarose gels prestained with ethidium bromide.

Quantitative RT-PCR

For gene expression analysis, quantitative RT-PCR (qRT-PCR) was carried out as previously described [29]. Briefly, total RNA was extracted from oocytes and converted to cDNA as described above. PCR reactions were performed on a LightCycler 480 (Roche Diagnostics) using 20-μl reactions containing 10 μl of FastStart SYBR Green Master Mix (Roche Diagnostics), 300 nM of each primer, and 1 μl of cDNA template. The thermal cycler program included a preincubation of 10 min at 95°C, followed by 45 cycles at 95°C for 20 sec, 62°C for 20 sec, and 72°C for 20 sec, with single fluorescence acquisition. Melting curves were performed to ensure gene-specific products. GAPDH was used as a reference gene for normalization, and relative transcript levels were calculated by the ΔΔC_T method. Primer pair sequences were as follows (5′ to 3′): CCNB1, gattggagaggttgatgttgag and aggtaatgctgtagagttggtg; MOS, gggcaacatcaccttgcacca and cgctgaccacgtctagggagta; GDF9, attagccttgattctctgccttctag and gtgtctcccacctaaatggttcag; and GAPDH (glyceraldehyde-3-phosphate dehydrogenase), gttccacggcacagtcaagg and actcagcaccagcatcaccc (sequences are forward and reverse, respectively).

Kinase Assay

The MPF activity was measured using histone H1 as in vitro substrate. Groups of 20 oocytes frozen in 5 μl were lysed by three cycles of thawing and freezing on dry ice. The kinase reaction was started by mixing 5 μl of PBS oocyte lysate with 5 μl of kinase assay buffer (45 mM β-glycerophosphate [pH 7.3], 20 mM MOPS [3-(N-morpholino)propansulfonic acid], 12 mM MgCl₂, 12 mM ethyleneglycoltetra-acetic acid, 0.1 mM ethylenediaminetetra-acetic acid, 2 mM Na₃VO₄, 10 mM NaF, 2 mM dithiothreitol [DTT], 2 mM PMSF, 2 mM benzamidine, 20 μg/ml of leupeptin, 20 μg/ml of pepstatin, 20 μg/ml of aprotinin, 1 mg/ml of histone H1, 4 μM protein kinase A-inhibiting peptide [Santa Cruz Biotechnology], 4 μM protein kinase C-inhibiting peptide [Promega], and 0.5 μCi [34 μM] of [γ-³²P]ATP [Amersham Pharmacia Biotech]). The mixtures were incubated at 37°C for 45 min. The reaction was stopped by adding 10 μl of ice-cold 2× SDS sample buffer (125 mM Tris-HCl [pH 6.8], 200 mM DTT, 4% [w/v] SDS, 0.1% [w/v] bromophenol blue, and 20% [w/v] glycerol). The samples were then boiled for 4–5 min, and the substrates were separated by SDS-PAGE with 15% gels using a Mini-PROTEAN II Dual Slab Cell (Bio-Rad Laboratories) at a constant 150 V for 1.5 h. Gels were dried onto 3-mm filters for 1 h at 60°C and exposed to phosphor-screens (Kodak; Amersham Pharmacia Biotech). Kinase activity was quantified using ImageJ software.

Jasplakinolide and Cytochalasin B Treatments

To stabilize actin filaments during CHX arrest, oocytes were incubated with 5 μg/ml of CHX and 20 μM Jasplakinolide (Jasp; Millipore) in IVM medium. To destabilize actin filaments during CHX arrest, oocytes were incubated with 5 μg/ml of cytochalasin B and CHX in IVM medium. After treatment, oocytes were then washed and in vitro matured. All three treatment groups contained the same concentration of dimethyl sulfoxide (1%), the solvent in which Jasp was dissolved at a stock concentration of 1 mM.

Statistical Analysis

Student t-test or one-way ANOVA followed by Tukey multiple-comparison test were carried out for Figure 1 (GraphPad Prism, version 6.00; GraphPad Software). The differences in the proportions of oocytes undergoing GVBD after treatments groups were examined by analysis of deviance using generalized linear models assuming binomial errors and with logit link functions using GenStat (VSN international, release 11.1). Data are presented as the predicted back-transformed mean ± SEM.

FIG. 1

Ovine oocytes released from CHX arrest undergo GVBD acceleration and have lower developmental competence. A) Representative meiotic stages assessed by Aceto-Orcein staining. B) Meiotic structures observed in oocytes cultured under different CHX concentrations (left) and 4′,6-diamidino-2-phenylindole staining of oocytes at the 0-h culture (control GV) or after 24 h in CHX (right). C) GVBD after 3-h release from CHX (arrested for 24 h) versus control oocytes at 3 hpm. D) Meiotic progression after 5, 15, and 22 h of maturation of oocytes released from CHX (arrested for 6 h) versus nontreated oocytes. E) Ovine COCs before maturation (0 hpm) and after 24 h of maturation (same magnification, ×100). F) Cumulus expansion after meiotic arrest with CHX (6, 12, or 24 h) and released for 24 h. Fold-increase in cumulus expansion (left) as well as polar body extrusion (right) were determined. G–I) CHX-arrested oocytes (treated for 6 and 24 h) were released after treatment, in vitro matured, and used for parthenogenesis (G), SCNT (H), or IVF (I). Cleavage was determined after 3 days of development, whereas blastocysts developed from activated/fertilized oocytes (blasts) were determined at Day 7. Error bars indicate the SD of three independent experiments. The P-values of significantly differing (P < 0.05) groups are presented. Bar = 20 μm.

Developmental Competence of CHX-Arrested Ovine Oocytes

Previous studies have reported inconsistent developmental outcomes of bovine and porcine CHX-treated oocytes [192021–22]. In the present study, we characterized the developmental competence of CHX-arrested ovine oocytes by investigating meiotic progression after release, cumulus expansion, and blastocyst development after parthenogenesis, SCNT, and IVF.

First, we carried out a dose-response experiment to determine the minimal CHX concentration required to arrest ovine oocytes at the GV stage. A CHX concentration of 5 μg/ml was 95% effective in arresting oocytes at the GV stage and was therefore chosen for all subsequent experiments (Fig. 1, A and B). We found that after 24-h CHX arrest, 95% of released oocytes had undergone GVBD at 3 hpm, whereas in control oocytes, only 2% had undergone GVBD at 3 hpm (Fig. 1C). Accelerated GVBD was also observed after release from a shorter, 6-h arrest period, with 90% of oocytes versus 40% of controls having undergone GVBD at 5 hpm (P = 0.02) (Fig. 1D). Meiotic acceleration was maintained at 15 hpm, at which time 87% of oocytes released from CHX arrest had progressed beyond metaphase I (72% AI and 15% metaphase II [MII]) compared to 35% of nontreated oocytes (33% AI and 2% MII; P = 0.01) (Fig. 1D). By 22 h, nearly all oocytes in both groups had reached MII (Fig. 1D).

We then asked whether CHX-treated oocytes were developmentally competent. We first investigated the ability of COCs to undergo cumulus expansion after release from CHX arrest (Fig. 1E) by measuring the area of COCs before and after maturation. COCs incubated in CHX for 6, 12, and 24 h did not undergo cumulus expansion before CHX removal. Interestingly, the length of CHX treatment was inversely correlated with the capacity of COCs to undergo cumulus expansion after release from CHX arrest. A reduction of 13%, 30%, and 43% of cumulus expansion was observed for COCs treated with CHX for 6, 12, and 24 h, respectively, before IVM for 24 h (Fig. 1F, left). Nonetheless, all four COC groups reached MII at a high rate as assessed by polar body extrusion (80–90%) (Fig. 1F, right).

Next, we assessed the effects of CHX treatment on preimplantation development. We preincubated oocytes with CHX for 6 or 24 h (nontreated control oocytes were matured immediately after collection) and, after washing CHX away to allow maturation, performed parthenogenesis, SCNT, and IVF. We then assessed developmental competence by measuring cleavage rates and blastocyst development. After 24 h of CHX treatment followed by parthenogenesis, we observed a significant decrease in cleavage (29/51 vs. 52/52 of control embryos) and blastocyst formation (12/51 vs. 35/52 of control embryos) (Fig. 1G). The 24-h treatment with CHX followed by SCNT also produced reduced cleavage (78/104 vs. 106/112 of control embryos) and blastocyst formation (10/104 vs. 55/112 of control embryos) (Fig. 1H). Treatment with CHX for 6 h gave intermediate results following either parthenogenesis (cleavage of 41/45 and blastocyst formation of 24/45) or SCNT (cleavage of 109/121 and blastocyst formation of 39/121) (Fig. 1, G and H). Following IVF, no significant differences were observed in cleavage after either 6 or 24 h of CHX treatment compared to control oocytes, but blastocyst development was reduced in the 24-h CHX group (58/294) compared to the 6-h CHX group (119/273) and the control group (94/268) (Fig. 1I).

Increased Accumulation of CCNB1 and pMAPK after CHX Arrest

Germinal vesicle breakdown is accompanied by increases in CCNB1 synthesis and phosphorylation of MAPK. Therefore, we hypothesized that increased levels of these proteins mediated accelerated GVBD in CHX-treated oocytes. We compared the protein levels of CCNB1 and pMAPK between control and CHX-treated oocytes. At 6 h after release, we observed a 3-fold increase in CCNB1 levels and an 18-fold increase in pMAPK levels compared to control oocytes matured for 6 h (Fig. 2). The results also show that changes in pMAPK are associated with phosphorylation rather than increased total MAPK levels.

FIG. 2

Premature accumulation of CCNB1 and pMAPK in oocytes released from CHX arrest. A) Protein levels as determined by Western blot analysis of CCNB1 and pMAPK in 24-h CHX-arrested oocytes (lane 2) and released oocytes after 6 h of IVM (lane 4) as well as in nontreated control oocytes before IVM (lane 1) and after 6 h of IVM (lane 3); Matured (24-h) oocytes were included as positive controls (lane 5). From 80 to 120 oocytes were loaded per lane, and alpha-tubulin was used as a loading control. B) Densitometric analysis of Western blots at 6 hpm after tubulin normalization showing relative protein levels of CCNB1 and pMAPK in oocytes released from CHX arrest versus controls. Error bars indicate the range of two independent biological replicates.

Polyadenylation and Transcription of CCNB1 and MOS Are Unchanged During CHX Treatment

One possible explanation for the increased translation of CCNB1 and phosphorylation of MAPK in CHX-treated oocytes is that polyadenylation of CCNB1 and MOS is initiated during CHX treatment. To test this possibility, we carried out an RL-PAT assay to compare the relative poly(A) tail length of these mRNAs in oocytes treated with CHX for 24 h. We found no polyadenylation in these transcripts before release from CHX arrest (Fig. 3A, lanes 1 and 2) and 3 h after release (Fig. 3A, lanes 3 and4), whereas extensive polyadenylation was detected in MII oocytes (Fig. 3A, lane 5). GDF9, which in contrast to CCNB1 and MOS undergoes deadenylation during oocyte maturation, was also unaffected by CHX treatment (Fig. 3A).

FIG. 3

Poly(A) tail length and levels of CCNB1, MOS, and GDF9 mRNA are unchanged in CHX-treated ovine oocytes. A) RL-PAT analysis of control oocytes matured for 0 h (lane 1), 3 h (lane 3), and 24 h (MII; lane 5) as well as CHX-treated (24-h) oocytes before release (lane 2) or after release and 3 h of maturation (lane 4). A representative gel of two biological replicates is shown. Pictures are color-inverted for display purposes. Sizes are indicated in base pairs; arrows point to polyadenylated mRNA. B) Relative transcript levels determined by qRT-PCR. Samples were treated and matured as described in A. Error bars represent the SD of three biological replicates.

As an alternative mechanism for early accumulation of our proteins of interest, we asked whether CCNB1 and MOS mRNA levels increased during CHX treatment. We carried out qRT-PCR and found no statistically significant differences in the levels of these transcripts after 24-h CHX arrest and 3 h after release from arrest (Fig. 3B).

Actin Filament Destabilization During CHX Arrest Is Associated with Accelerated GVBD after Release

A recent study in zebrafish and mouse oocytes showed that CCNB1 mRNA is stored in granules associated with actin filaments, which are released upon oocyte maturation [16]. To determine if premature release of actin-associated mRNAs could explain accelerated maturation following CHX treatment, we examined whether interfering with the stability of actin filaments during CHX arrest also affected GVBD. First, we assayed different concentrations (2.5, 5, 10, and 20 μM) of the actin filament-stabilizing agent Jasp in ovine oocytes treated for 6 h and found that the proportion of oocytes remaining at the GV stage was dose dependent (0%, 8%, 38%, and 85%, respectively). Then, we stabilized or destabilized actin filaments during CHX arrest with 20 μM Jasp or 5 μg/ml of cytochalasin B, respectively. After 6 h of treatment with CHX and either Jasp or cytochalasin B, oocytes were thoroughly rinsed and matured for 3 h. GVBD was delayed in the CHX/Jasp cotreatment group (39%, n = 156) compared to the CHX-alone group (66%, n = 168), whereas it was accelerated in the CHX/cytochalasin B cotreatment group (80%, n = 156) (Fig. 4A). Treatment of oocytes with Jasp alone did not prevent resumption of meiosis (69%, n = 65) (Fig. 4A). We also found that all oocytes following release from CHX/Jasp could progress beyond GVBD after 24 h of maturation (not shown), thus confirming that the GVBD delay in this group was due to actin filament stabilization and not toxic effects of the treatment. To confirm whether the effect on GVBD of Jasp in CHX-arrested oocytes was due to an effect on MPF activation, we performed a histone H1 kinase assay. The results show that MPF activity increased 1.8-fold in oocytes cultured for 3 h after CHX arrest compared to those collected after the 6 h of arrest (Fig. 4B). This increase correlates with the high proportion of GVBD observed (Fig. 4A). In contrast, oocytes treated with both CHX and Jasp showed very low levels of MPF activity. MPF levels in oocytes treated with both CHX and cytochalasin B were not different from those of the group released from CHX arrest. Oocytes cultured with Jasp or cytochalasin B alone showed increases in MPF. Taken together, these functional assays established an association between actin filament stability during meiotic arrest, MPF activation, and the kinetics of GVBD.

FIG. 4

Stabilization of actin filaments during CHX arrest prevent accelerated GVBD after release. A) Percentage of GVBD in oocytes treated with different compounds and matured for 3 h after release from CHX arrest. Error bars represent the SEM of four independent biological replicates. *P < 0.01. B) Histone H1 kinase activity in oocytes treated under different conditions. Quantification of band intensities is presented in the histogram. Values represent the fold-differences to the 6-h CHX-treated group, which was normalized to a value of one.