Animals

Adult male and female mice of the ICR strain (CLEA Japan Inc., Osaka, Japan) were housed in a temperature-controlled room with free access to the CE-7 commercial diet (CLEA Japan Inc.) and water. All animal care and experiments were carried out according to the Guidelines of Animal Experimentation, Faculty of Science, Okayama University, Japan.

Northern blot analysis

Total RNA from the anterior pituitaries of ovariectomized female mice was extracted using the method of Chomczynski and Sacchi (1987). Total cellular RNA was denatured by incubation at 65°C for 15 min with 1×MOPS, (0.02 M MOPS, 8 mM sodium acetate, 1 mM EDTA), 2.2 M formaldehyde and 50% (w/v) formamide. Total RNA (10 μg) was electrophoresed on a 1% agarose gel. The RNA was transferred to a nylon membrane (hybond-N+ Amersham, Arlington Hights, IL) by electroblotting (30 V, 16 hr). The transferred RNA was fixed with an UV lamp for 5 min. The membrane was prehybridized in 5×SSPE, 50% formamide, 5×Denhardt's solution, 10% dextran sulfate, and 1 mg/ml herring sperm DNA at 42°C for 2 hr. Hybridization was carried out at 42°C for 16 hr in hybridization buffer containing 50 ng [α-³²P]dCTP-labelled probe. After the hybridization, the membrane was washed with 1×SSC and 0.1% SDS at 42°C for 20 min and 0.5×SSC and 0.1% SDS at 42°C for 20 min. Hybridized signals were detected by autoradiography.

In situ hybridization analysis of TGF-α mRNA-expressing cells

Pituitaries were quickly fixed overnight in 4% paraformalde-hyde in 0.01 M phosphate-buffered saline (PBS, pH 7.6) at 4°C. They were then embedded in paraffin and sectioned at a thickness of 5 μm thick. The sections were digested with 10 mg/ml proteinase K (Merck, Darmstad, Germany) at 37°C for 30 min. The reaction of proteinase K was blocked by 0.2% (w/v) glycine in 0.01 M PBS. The sections were fixed with 4% paraformaldehyde in 0.01 M PBS and were incubated in 0.25% acetic anhydride in 0.1M triethanolamine for 10 min at room temperature. The mouse TGF-α cDNA probe (pcrmTGFα-ST1), rat GH cDNA probe, and rat PRL cDNA probe were labelled with digoxigenin (DIG)-11-UTP at 37°C overnight (20 hr) by random primer using the DIG DNA labeling and detection kit (Boehringer Mannheim, Germany). pBR328 plasmids were labelled and used as a negative control for in situ hybridization.

The sections were hybridized at 42°C overnight in a solution of 5×SSPE, 1×Denhardt's solution, 10% (w/v) sodium dextran sulfate, 50% (v/v) deionized formamide, 120 μg/ml denatured herring sperm DNA, and 0.3 ng/μl DIG-labelled probe. The slides were washed in 1×SSC at room temperature for 10 min followed by 1×SSC and 0.5×SSC at 45°C for 15 min each. The final wash was carried out in 0.2 × SSC at room temperature for 1 min. Nonspecific binding was blocked by 0.5% (w/v) BSA in TN buffer (0.1 M Tris-HCl, 0.3 M NaCl, pH 7.5) for 30 min. Anti-DIG-alkaline phosphatase conjugate (1:1000) was applied to the slides and kept at room temperature for 1 hr. The slides were washed twice in 0.2% (v/v) Tween 20 TN buffer for 10 min. Nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP) were used as chromogens for hybridization detection. Color development was carried out for 20 hr at room temperature.

Preparation of cDNA Probes

A 502-bp mouse TGF-α cDNA clone (pcrmTGFα-ST1) was generated as follows. DNA fragments encoding a portion of mouse TGF-α was obtained from total RNA from ICR mice by RT-PCR. Oligonucleotide primers for TGF-α were designed based upon the mouse sequence and were synthesized by the Gibco BRL Custom Primers, Life Technologies Asia Pacific (Yokohama, Japan). The primer sequences and the location on the nucleotide sequences were as follows: TGF-α 5′ (AGCCAGAAGAAGCAAGCCATCACT, 367–390), TGF-α 3′ (CTCATTCTCGGTGTGGGTTAGCAA, 845–868). The cDNA fragments were subcloned into pGEM3zf(+). Clones were sequenced using fluorescent primers and an automated DNA sequencer, and were confirmed to be cDNAs encoding a portion of the mouse TGF-α.

The rat GH cDNA (790 bp) cloned to the Hind III site of the plasmid pBR322, and rat PRL cDNA (823 bp) cloned to the Pst 1 site of the plasmid pBR322 were kindly provided by Dr. J.A. Martial (University of Liege, Belgium).

Isolation of pituitary cells

Anterior pituitaries obtained from 2-month-old male mice were dissociated with 0.5% trypsin (0.5% w/v; DIFCO, Detroit, MI) as previously described (Oomizu et al., 1998). Cell viability was checked using the trypan blue exclusion test and was usually found to be more than 95%. The isolated pituitary cells were suspended in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F12 medium without phenol red (DMEM/F12 medium, Sigma Chemical Co., St. Louis, MO) containing fetal calf serum (FCS, 10%, v/v; Gibco BRL, Life Technologies, Inc., Rockville, MD). The cells were seeded on poly-L-lysine-(Sigma Chemical Co.) coated plastic coverslips (diameter 13 mm; Sumitomo, Tokyo, Japan) in 24-well tissue-culture plates (Becton Dickinson, Lincoln Park, NJ) at a cell density of 5 × 10⁵ cells/ml per well. The culture was allowed to proceed in a humidified atmosphere of 5% CO₂ and 95% air at 37°C.

Exposure to a TGF-α-specific antibody

After a 3-day culture in DMEM/F12 medium containing 10% FCS, the pituitary cells were cultured in serum-free DMEM/F12 medium supplemented with hydrocortisone (100 μg/l), triiodothyro-nine (400 ng/l), transferrin (10 mg/l), bovine glucagon (10 ng/ml), parathyroid hormone (200 ng/l), insulin (1 μg/l), and sodium selenite (5 μg/l) for another 3 days. Each treatment was performed on three plastic coverslips. An antibody specific for human TGF-α (1 μg IgG, Ab-3, Oncogene Science, Uniondale, NY) was added to the medium (500 μl) for 5 days with estradiol-17β (E2, 10⁻⁹ M). The TGF-α antibody treated with excess human TGF-α (1 ng) for 30 min at room temperature was also added to the medium with E2. The medium containing the antibody and E2 was changed daily. After a 5-day exposure to the antibody specific to TGF-α, a 5-bromo-2′-deoxyuridine (BrdU) solution of the cell proliferation kit (Amersham) was added to the culture media (3 mg/ml) for 12 hr to assess DNA-replicating cells. The cultured cells were fixed in Bouin's solution for 30 min at room temperature, and immunocytochemical detection was performed as described previously (Oomizu et al., 2000).

Quantification of the immunolabelled cells

Cells were observed under a light microscope at ×600 magnification. The fields were scanned across the coverslip to avoid overlap. In each field, immunopositive and immunonegative cells were counted, and more than 1000 cells were observed from each coverslip. The percentages of BrdU-labelled cells indicate those of cells that had a densely labelled nucleus in relation to the total cells. Each group consisted of three coverslips.

Ovariectomy and estrogen treatment

Two-month-old female mice were ovariectomized under ether anesthesia. Seven days after the ovariectomy a single subcutaneous injection of E2 (Sigma Chemical Co.) was given at a dose of 250 ng in 0.05 ml of sesame oil. Ovariectomized female mice treated with sesame oil only served as controls. Pituitaries were obtained 48 hr after the E2 injection.

cDNA synthesis and PCR amplification

Total RNA (2 μg) in a final volume of 20 μl was subjected to reverse transcription using Superscript II Reverse Transcriptase (Gibco-BRL) with random primers according to the manufacturer's instructions. Each PCR was performed using primer pairs specific for TGF-α, as described, and primer pairs specific for β-actin, as based on a previous report (Matsuda and Mori, 1997). The size of the resulting DNA fragment following PCR amplification was 502 base pairs (bp) for TGF-α and 469 bp for β-actin. These primers generate PCR products of 502 bp for TGF-α and 469 bp for β-actin respectively. These primers were synthesized by Gibco BRL Custom Primers, Life Technologies Asia Pacific (Yokohama, Japan). PCR was performed using Takara Taq (Takara, Otsu, Japan) and a thermal cycler (Gene Amp PCR System 9700, Applied Biosystems, Branchburg, NJ). The conditions for PCR were as follows: after activation of DNA polymerase by a 20-sec incubation at 95°C, 40 cycles (for TGF-α cDNA) and 25 cycles (for β-actin cDNA) of reactions, including denaturation for 30 sec at 95°C and extension for 1 min at 60°C, followed by an additional extension for 10 min at 60°C.

A 10-μl aliquot of each reaction was electrophoresed on 2% agarose gel, stained with ethidium bromide, and photographed under ultraviolet rays.

Statistics

Data are presented as the mean±S.E.M and were analyzed by analysis of variance followed by Duncan's multiple range tests.

Detection of TGF-α mRNA in the anterior mouse pituitary by Northern blot analysis

Northern blot analysis using the mouse TGF-α cDNA probe revealed that a single band of TGF-α mRNA (4.7 kb) was expressed in the mouse anterior pituitary gland (Fig. 1).

Fig. 1

Northern blot analysis of pituitary TGF-α mRNA. Total RNA (10 μg) obtained from adult female mice was electrophoresed on a 1% agarose gel and then transferred to a nylon membrane. The membrane was hybridized with ³²P-dCTP-labelled mouse TGF-α cDNA probes. The relative positions of the 28S and 18S ribosomal RNAs are shown.

In situ hybridization analysis of TGF-α mRNA-expressing cells

TGF-α mRNA-expressing cells were found to be evenly distributed throughout the anterior pituitary gland, but not the intermediate or posterior lobes (Fig. 2A). TGF-α mRNA-expressing cells were round, oval, and medium-sized (Fig. 2B). In control experiments for in situ hybridization, no signal was detected when DIG-labelled pBR328 probes were used as controls (Fig. 2C). In adult male pituitaries, TGF-α mRNA-expressing cells accounted for 65% (±2.1, n=3) of the total pituitary cells, and for 55% (±1.7, n=3) in adult female pituitaries.

Fig. 2

TGF-α mRNA expression in the male mouse pituitary was analyzed by in situ hybridization. A: TGF-α mRNA-expressing cells were evenly distributed throughout the anterior pituitary. TGF-α mRNA-expressing cells were observed in a subpopulation of secre-tory cells in the anterior lobe (a), but not in the intermediate (i) or posterior lobes (p). Bar=50 μm B: TGF-α mRNA-expressing cells in the anterior pituitary (arrow) were round, oval and medium sized. Bar=10 μm C: in situ hybridization using pBR328 DIG-labelled probes detected no signals in the anterior pituitary cells. Bar=10 μm

Characterization of TGF-α mRNA-expressing cells

For the determination of the cell types of TGF-α mRNA-expressing cells, serial sections were studied by non radio-isotopic in situ hybridization using cDNA probes for TGF-α mRNA (Fig. 3A and 3C), GH mRNA (Fig. 3B) and PRL mRNA (Fig. 3D). Most of the GH mRNA-expressing cells contained TGF-α mRNA (79–83%), whereas only a small population of PRL mRNA-expressing cells contained TGF-α mRNA (1–3%).

Fig. 3

Determination of TGF-α mRNA-expressing cell types by in situ hybridization using serial sections of the anterior pituitary glands from adult male (A and B), and female (C and D) mice. in situ hybridization was carried out using cDNA probes for TGF-α mRNA (A and C), GH mRNA (B) and PRL mRNA (D). Paired photographs of A and B, and those of C and D are adjacent sections obtained from the serial sections of mouse pituitary glands (5 μm thick), respectively. The cells (#1, #2, #3 and #4) expressed both TGF-α mRNA and GH mRNA. The cells (#5) expressed both TGF-α mRNA and PRL mRNA, while the cells (#6 and #7) expressed PRL mRNA, but not TGF-α mRNA. Bar=20 μm

Effects of anti-TGF-α antibody treatment on DNA replication in pituitary cells

E2 treatment for 5 days significantly increased the percentage of BrdU-labelled cells (p<0.01). Treatment of pituitary cells with a combination of E2 and anti-TGF-α anti-bodies did not increase the number of BrdU-labelled cells (Fig. 4). The TGF-α antibody with excess TGF-α did not affect E2-induced increase in the percentage of BrdU-labelled cells.

Fig. 4

Effect of E2 and anti-TGF-α antibody on the number of BrdU-labelled pituitary cells. After a 3-day culture in serum-free DME/F12 medium, an antibody specific for human TGF-α (1 μg IgG1) was added to the medium (500 μl) for 5 days with estradiol-17β (E2, 10⁻⁹ M). After the exposure to E2 and the antibody, BrdU solution was added to the culture media for 12 hr to assess DNA synthesizing cells. E2 treatment increased the number of BrdU-labelled cells compared with the control (*p<0.01). Treatment with a combination of anti-TGF-α antibody and E2 decreased the number of BrdU-labelled cells compared with E2 treatment (#p<0.01).

RT-PCR analysis of TGF-α mRNA levels

To determine the effects of E2 on TGF-α gene expression, the relative TGF-α mRNA content was measured using semiquantitative RT-PCR. The technical validation of this assay is depicted in Fig. 5A,B. Various amounts of RT products (in volume, 0.5, 1, 1.5, 2 μl) for TGF-α and β-actin cDNAs were amplified to ensure linearity for the PCR-amplification (Fig. 5A). The PCR products for TGF-α mRNA and β-actin mRNA increased in accordance with the increase in RT products (templates). TGF-α mRNA levels were determined using 1 μl of RT product, and were normalized according to the intensity of the co-amplified β-actin cDNA value. PCR analysis under this condition revealed an increase in TGF-α mRNA levels in response to E2 treatment compared with the control treatment (Fig. 5C).

Fig. 5

Analyses of TGF-α and β-actin mRNAs amplified by RT-PCR. Effect of E2 treatment on the amount of TGF-α mRNA was studied in the pituitary cells of ovariectomized mice. E2 was subcutaneously injected to the ovariectomized mice at a dose of 250 ng/mouse. Pituitaries were obtained after 48 hr of the injection. RNA samples were collected and subjected to RT-PCR. A: The analysis of the linearity of TGF-α and β-actin cDNAs in relation to the amount of RT products. PCR amplification was carried out with various amounts of (0.5–2 μl) of the RT products (for TGF-α and β-actin) from controls and E2-treated mice. Each PCR product was electrophoresed on a 2% agarose gel, stained with ethidium bromide, and photographed under UV irradiation. The number above the gel pictures depict the amount of RT products (μl). The band intensities of TGF-α and β-actin cDNAs were increased with increasing amount of RT products. B: The analysis of quantiataive changes in the bands depicted in A. The relative amounts of TGF-α mRNA were normalized according to the β-actin mRNA levels in each sample. C: The summary of the change of TGF-α mRNA levels induced by E2 treatment. The TGF-α mRNA levels were normalized as performed in B, and the relative values were expressed by regarding the control value as 1.0. Each column represents the mean (±S.E.M) of three independent experiments. For the semiquantitative analysis of the relative amounts of TGF-α mRNA the band intensities of 1 μl of RT product were used. *p<0.01, significantly different from the control.