Translator Disclaimer
1 October 2010 Arginine Kinase from the Tardigrade, Macrobiotus occidentalis: Molecular Cloning, Phylogenetic Analysis and Enzymatic Properties
Kouji Uda, Mikako Ishida, Tohru Matsui, Tomohiko Suzuki
Author Affiliations +
Abstract

Arginine kinase (AK), which catalyzes the reversible transfer of phosphate from ATP to arginine to yield phosphoarginine and ADP, is widely distributed throughout the invertebrates. We determined the cDNA sequence of AK from the tardigrade (water bear) Macrobiotus occidentalis, cloned the sequence into pET30b plasmid, and expressed it in Escherichia coli as a 6x His-tag—fused protein. The cDNA is 1377 bp, has an open reading frame of 1080 bp, and has 5′- and 3′-untranslated regions of 116 and 297 bp, respectively. The open reading frame encodes a 359-amino acid protein containing the 12 residues considered necessary for substrate binding in Limulus AK. This is the first AK sequence from a tardigrade. From fragmented and non-annotated sequences available from DNA databases, we assembled 46 complete AK sequences: 26 from arthropods (including 19 from Insecta), 11 from nematodes, 4 from mollusks, 2 from cnidarians and 2 from onychophorans. No onychophoran sequences have been reported previously. The phylogenetic trees of 104 AKs indicated clearly that Macrobiotus AK (from the phylum Tardigrada) shows close affinity with Epiperipatus and Euperipatoides AKs (from the phylum Onychophora), and therefore forms a sister group with the arthropod AKs. Recombinant 6x His-tagged Macrobiotus AK was successfully expressed as a soluble protein, and the kinetic constants (Km, Kd, Vmax and kcat) were determined for the forward reaction. Comparison of these kinetic constants with those of AKs from other sources (arthropods, mollusks and nematodes) indicated that Macrobiotus AK is unique in that it has the highest values for kcat and Kd/Km (indicative of synergistic substrate binding) of all characterized AKs.

INTRODUCTION

Phosphagen (guanidino) kinases catalyze the reversible transfer of the high-energy phosphoryl group of ATP to naturally occurring guanidine compounds. Members of this enzyme family play a key role in animals as ATP-buffering systems in cells that display high and variable rates of ATP turnover. Phosphorylated high-energy guanidines are referred to as Phosphagens. In vertebrates, phosphocreatine is the only Phosphagen, and the corresponding Phosphagen kinase is creatine kinase (CK). In contrast, invertebrates have various Phosphagens in addition to phosphocreatine: phosphoglycocyamine (catalyzed by glycocyamine kinase: GK), phosphotaurocyamine (taurocyamine kinase: TK), phosphohypotaurocyamine (hypotaurocyamine kinase: HTK), phospholombricine (lombricine kinase: LK) and phosphoarginine (arginine kinase: AK). Phosphagen kinases are phylogenetically separated into two distinct groups: the AK group, which includes AK and HTK, and the CK group, which includes CK, GK, LK and TK (Ellington, 2001; Wyss et al., 1992; Schlattner et al., 2005; McLeish and Kenyon, 2005; Ellington and Suzuki, 2006; Uda et al., 2005a). Interestingly, several AKs such as those from the echinoderm Stichopus and the annelid Sabellastarte are clustered in the CK group, indicating that they have evolved secondarily from CK (Suzuki et al., 1999; Uda and Suzuki, 2007).

Most AKs are monomers of 40 kDa, but in some species they exist as dimers (Seals and Grossman, 1988; Suzuki et al., 1999) or contiguous dimers (two-domain AKs), presumably as a result of gene duplication and subsequent fusion (Suzuki et al., 1997; Suzuki et al., 1998).

Typical AKs are most widely distributed among organisms such as arthropods, mollusks, nematodes, cnidarians, poriferaes, protozoans (ciliates and choanoflagellates), and bacteria, indicating their ancient origin (Andrews et al., 2008; Uda et al., 2006). In three major invertebrate groups (arthropods, nematodes, and mollusks), AK is the only phosphagen kinase (Uda et al., 2006; Wickramasinghe et al., 2008). We reported previously that invertebrate AKs are phylogenetically separated into two groups: those from lophotrochozoans (mollusks, platyhelminths and sipunculids) and those from ecdysozoans (arthropods and nematodes) (Uda et al., 2006).

Tardigrades, also known as water bears, are small animals believed to be closely related to arthropods (Nelson, 2002). In adverse environments, terrestrial tardigrades adopt the “tun” state. In this state, they can survive extreme conditions, including high or subzero temperatures, high or low pressure, and x-ray irradiation (Ramlov and Westh, 2002; Horikawa et al., 2006; Jonsson et al., 2008; Seki and Toyoshima, 1998). Thus, tardigrades are commonly used as models for elucidating the molecular basis that permits toleration of extreme environments and stresses.

The tardigrade Macrobiotus occidentalis generally lives on the moss Bryum argenteum, and is reported to tolerate hydrostatic pressures as high as 600 MPa (Seki and Toyoshima, 1998). In this study, we determined for the first time the cDNA-derived amino acid sequence of tardigrade AK. In addition, we identified 46 new AK sequences in DNA databases. Phylogenetic analyses of protostome AKs indicated that the Macrobiotus AK sequence shows the highest identity with onychophoran Aks, and that they form a sister group with the arthropod AKs. We also determined the kinetic parameters of Macrobiotus AK, and found that this AK is unique in having the highest values for kcat and Kd/Km compared with other AKs.

MATERIALS AND METHODS

cDNA amplification and sequence determination of AK from Macrobiotus occidentalis

Specimens of Macrobiotus occidentalis (600–700 µm in length), living on the moss Bryum argenteum, were collected from Kochi, Japan. Total RNA was isolated from about 100 specimens by acid guanidinium thiocyanate-phenolchloroform extraction (Chomczynski and Sacchi, 1987). mRNA was purified from total RNA using a poly (A)+ isolation kit (Nippon Gene, Tokyo, Japan). Single-stranded cDNA was synthesized with Ready-To-Go You-Prime First-Strand Beads (Amersham Pharmacia Biotech, NJ, USA) with a lock-docking oligo-dT primer with Sma I and BamH I sites (5′CCCGGGATCCTTTTTTTTTTTTTTTTTVN) (Borson et al., 1992).

The 3′-half of cDNA of Macrobiotus AK was amplified using the lock-docking oligo-dT primer and a 256-fold “universal” Phosphagen kinase primer (phos. con.; 5′-GTNTGGGTNAAYGARGARGAYCA) designed from the highly conserved sequences of Phosphagen kinases (Suzuki and Furukohri, 1994) with Ex Taq DNA polymerase (Takara, Kyoto, Japan) as the amplifying enzyme. PCR amplification was performed for 30 cycles, each consisting of denaturation for 30 s at 94°C, annealing for 30 s at 60°C and primer extension for 90 s at 72°C. The amplified product (600 bp) was purified by agarose gel electrophoresis and subcloned into the pGEM-T Easy Vector (Promega, WI, USA). Nucleotide sequences were determined with an ABI PRISM 3130 DNA sequencer using a BigDye Terminators v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA).

A poly (G)+ tail was added to the 3′ end of the Macrobiotus cDNA pool with terminal deoxynucleotidyl transferase (Promega, WI, USA). The 5′-half of the cDNA of AK was then amplified using the oligo-dC primer (5′-GAATTC18) and a specific primer (kuma AK R1; 5′-CGGGCAGAAAGTCAAATAACC) designed from the sequence of the 3′ region. The product was re-amplified using oligo-dC primer and a specific primer (kuma AK R2; 5′-GCCTCGATTT-GTTTCACACCCTC). The amplified product (900 bp) was purified, subcloned, and sequenced, as described above.

Cloning into pET30b plasmid and expression of Macrobiotus AK

The open reading frame of Macrobiotus AK was amplified using two primers, Kuma-AK-cF1-Nde (5′-TCATATGGCCGCTGTTGATCACGCTC, Nde I site underlined) and Kuma-AK-cR2-6xH (5′CTTAGTGGTGGTGGTGGTGGTGAGAAGCTTTCTCCAGCTTGA, 6x His-tag underlined), subcloned into the pGEM-T Easy Vector and sequenced. The plasmid vector was digested with Nde I and Eco RI and the Macrobiotus AK fragment cloned into Nde I/Eco RI site of pET30b vector (Novagen, WI, USA). The Macrobiotus-AK/ pET30b plasmid was sequenced, and it was confirmed that there was no intended mutation in the coding region of Macrobiotus AK cDNA.

The fusion protein with a hexameric His tag at the C-terminal end, was expressed in E. coli BL21(DE3) cells (Novagen, WI, USA) by induction with 0.5 mM IPTG at 25°C for 36 h. The cells were resuspended in PBS buffer, sonicated, and the resultant soluble recombinant protein was purified by affinity chromatography using Ni-NTA Superflow (QIAGEN, CA, USA). The purity of the expressed enzymes was verified by SDS-PAGE. The enzymes were placed on ice until use, and enzymatic activity was determined within 12 h.

Enzyme assays

Enzyme activity was measured using the NADH-linked spectrophotometric assay at 25°C (Fujimoto et al., 2005) and determined for the forward reaction (Phosphagen synthesis). The reaction mixture (total volume of 1.0 ml) contained 0.65 ml of 100 mM Tris/HCl (pH 8), 0.05 ml of 750 mM KCl, 0.05 ml of 250 mM Mg-acetate, 0.05 ml of 25 mM phosphoenolpyruvate made up in 100 mM imidazole/ HCl (pH 7), 0.05 ml of 5 mM NADH made up in 100 mM Tris/HCl (pH 8), 0.05 ml of pyruvate kinase/lactate dehydrogenase mixture made up in 100 mM imidazole/HCl (pH 7), 0.05 ml of an appropriate concentration of ATP made up in 100 mM imidazole/HCl (pH 7), and 0.05 ml of recombinant enzyme. The reaction was started by adding 0.05 ml of an appropriate concentration of arginine made up in 100 mM Tris/HCl (pH 8).

The kinetics of Phosphagen kinase can be explained as a random-order, rapid-equilibrium kinetic mechanism (Morrison and James, 1965), and the Kd is obtained by fitting data directly according to the method of Cleland (1979), using the software written by R. Viola (Enzyme kinetics Programs, ver. 2.0).

Temperature/activity profiles of His-tagged Macrobiotus AK and His-tagged Nautilus AK were determined between 10 and 45°C under the substrate concentrations of 9.52 mM arginine and 4.76 mM ATP. Activity was measured in the Tris buffer adjusted to pH 8.0 at each assay temperature.

Search for cDNA sequence of AKs through available databases

cDNA sequences of AKs were retrieved from the GenBank EST ( http://www.ncbi.nlm.nih.gov/sites/entrez) or Trace Archive ( http://www.ncbi.nlm.nih.gov/Traces/home/) databases (Table 1) using TBLASTN, and fragments coding AK sequences were assembled to yield a complete sequence.

Alignment of amino acid sequences of invertebrate AKs and construction of phylogenetic tree

Multiple sequence alignment of Macrobiotus AK and invertebrate AKs was done with the ClustalW program available from the DDBJ homepage ( http://ddbj.nig.ac.jp/). The PAM model, however, was used to construct the distance matrix; otherwise, the default settings were used for the alignment. A Neighbor-Joining (NJ) tree with bootstrap analysis (1000 replications) was also constructed using a program available on the DDBJ homepage ( http://www.ddbj.nig.ac.jp/). The default setting was used for tree construetion. The Maximum-Likelihood (ML) analysis with the approximate likelihood-ratio test for branches (aLRT; Anisimova and Gascuel, 2006) was performed in the program PhyML v3.0 (Guindon and Gascuel, 2003) using the LG amino acid replacement matrix.

Table 1.

AKs used for the phylogenetic analysis.

t01_796.gif

RESULTS AND DISCUSSION

cDNA for AK from Macrobiotus occidentalis was amplified by PCR and cloned into the plasmids pGEM-T Easy and pET30b. Fig. 1 shows the nucleotide and derived amino acid sequences of Macrobiotus AK. The nucleotide sequence consists of 1377 bp, with an open reading frame (ORF) of 1080 bp, and 5′- and 3′-untranslated regions of 116 and 297 bp, respectively. The sequence was deposited into the DDBJ database (accession number: AB537977). This is the first reported AK sequence from a tardigrade.

The ORF codes were consistent with a protein of 359 amino acid residues, with a calculated molecular mass of 40,060 Da and an estimated pl of 6.81. When the amino acid sequence was compared with Limulus AK, for which the crystal structure has been determined (Zhou et al., 1998), it was found that Macrobiotus AK completely conserved all key residues believed necessary for AK function (underlined in Fig. 1). Conserved residues include seven that interact with the substrate arginine in Limulus AK (S63, G64, V65, Y68, E228, C274 and E317) and five residues that interact with the substrate ADP (R127, R129, R232, R283 and R312). The results show that Macrobiotus AK and Limulus AK may have very similar substrate recognition systems.

At present, at least 60 complete sequences of invertebrate AKs have been deposited in protein or DNA databases. We also know that many EST or genomic DNA databases contain fragmented and non-annotated AK sequences. We performed a comprehensive search for AK fragments across multiple databases using known AK sequences as references, and assembled the fragments into complete cDNA sequences. As a result, we obtained 46 complete AK sequences: 26 from arthropods (including 19 from Insecta (Coleoptera: Tribolium castaneum, Diptera: Ceratitis capitata, Drosophila pseudoobscura, Glossina morsitans, Lutzomyia longipalpis, Phlebotomus papatasi, Cochliomyia hominivorax, Teleopsis dalmanni, Hemiptera: Nilaparvata lugens, Rhodnius prolixus, Hymenoptera: Nasonia vitripennis, Lysiphlebus testaceipes, Lepidoptera: Danaus plexippus, Spodoptera frugiperda, Manduca sexta, Trichoplusia ni, Ostrinia nubilalis, Orthoptera: Gryllus bimaculatus, Phthiraptera: Pediculus humanus)), three from cnidarians, four from mollusks, 11 from nematodes and two from onychophorans (see Table 1). These onychophoran AK sequences are the first to be reported for that taxon.

Fig. 1.

Nucleotide and derived amino acid sequence of cDNA of Macrobiotus AK. Primers used to amplify the cDNA are shown by arrows. The key residues interacting with the substrates, arginine and ADP, are underlined.

f01_796.eps

The amino acid sequences of 104 invertebrate AKs, including Macrobiotus AK, the 46 AKs obtained by our in silico analyses (Table 1), and Paragonimus TK and Siphonosoma HTK (both of which evolved from AK genes; Uda et al., 2005; Jarilla et al., 2009), were aligned using the ClustalW program (data not shown). The sequence of Macrobiotus AK showed the highest identity (75%) with AK from the onychophorans Epiperipatus and Euperipatoides, 62–74% with arthropod AKs, 59–65% with nematode AKs, and 49–55% with mollusk AKs.

A phylogenetic tree was constructed from the above alignments using the ML (Fig. 2) and NJ (data not shown) methods. The two trees show similar topology, and the protostome AK sequences are separated into two distinct groups: lophotrochozoans (mollusks, platyhelminths and sipunculids) and ecdysozoans (arthropods, nematodes, onychophorans and tardigrades). Recent molecular phylogenetic studies suggest three possibilities for the phylogeny of ecdysozoas: (a) Tardigrada and Onychophora are included within Arthropoda (Colgan et al., 2008), (b) Tardigrada has close affinity with Onychophora, and they form a sister group with Arthropoda (Mallatt and Giribet, 2006), and (c) Onychophora has close affinity with Arthropoda, and they form a sister group with Tardigrada (Dunn et al., 2008). Our phylogenetic tree (Fig. 2) indicates that AK from the tardigrade Macrobiotus has very close affinity with onychophoran AKs, and forms a sister group with the arthropod AKs. Thus, our analyses support possibility (b), which was originally deduced from 28S and 18S rRNA analyses using the ML method (Mallatt and Giribet, 2006; Mallatt et al., 2004).

Fig. 2.

Maximum-likelihood (ML) tree for amino acid sequences of invertebrate AKs. The tree was constructed using the PhyML program. The approximate likelihood-ratio test (aLRT) values are shown at the branching points. Homo muscle-type creatine kinase was used as an outgroup. Accession numbers of the sequences are listed in Table 1. Macrobiotus AK is boxed, and the 46 newly assembled sequences are marked by asterisks.

f02_796.eps

Recombinant 6× His-tagged Macrobiotus AK was successfully expressed as a soluble protein, and purified by affinity chromatography. Fig. 3 shows the result of SDSPAGE of the purified recombinant enzyme. The recombinant enzyme gave a major single band with a molecular mass of 40 kDa (lane 3), suggesting that the enzyme is sufficiently pure to allow determination of its kinetic constants.

Fig. 3.

SDS-PAGE of His-tagged Macrobiotus AK. Lane 1, marker proteins (Precision Plus Protein Standards, Bio Rad). Lane 2, soluble proteins from the E. coli crude extract. Lane 3, His-tagged Macrobiotus AK enzyme purified by affinity chromatography.

f03_796.eps

Table 2.

Comparison of kinetic constants of invertebrate AKs at 25°C for the forward reaction (Phosphagen synthesis).

t02_796.gif

The kinetic constants for Macrobiotus AK were obtained using software written by R. Viola (Enzyme Kinetics Programs, ver. 2.0); the results are summarized in Table 2. The kinetic constants were compared with those of AKs from other sources: the arthropods Locusta (Wu et al., 2007; Li et al., 2006), Neocaridina (Iwanami et al., 2009), Cissites (Tanaka et al., 2007), and Periplaneta (Brown and Grossman, 2004), the nematode Toxocara (Wickramasinghe et al., 2007), the mollusks Nautilus (Uda and Suzuki, 2004; Matsumoto and Suzuki, unpublished data), Scapharca (Takeuchi et al., 2004), Octopus (Takeuchi et al., 2004), and Crassostrea (Fujimoto et al., 2005), and the sea anemone Anthopleura (Tada et al., 2008; Tada et al., 2010) (Table 2).

The values for Kmarg (0.68 mM) and KmATP (0.86 mM) from Macrobiotus AK are in the range found for other AKs: 0.12–1.44 mM for Kmarg and 0.14–2.17 mM for KmATP

The Kd/Km and kcat values for Macrobiotus AK appear to be unique. In many Phosphagen kinase reactions, two substrates, arginine (or phosphoarginine) and MgATP (or MgADP) in AK reaction, typically exhibit synergistic binding to AK. That is, binding of the first substrate facilitates binding of the second substrate. In terms of kinetic constants, this means that Kd, the dissociation constant in the absence of the second substrate, is higher than Km (Kd/Km > 1). This synergism may be associated with substrate-induced conformational changes within the tertiary complex. In previous works, we showed that the amino acid residues at positions 62 and 193 (positions relative to Limulus AK), which are conserved in normal Aks, including Macrobiotus AK, as Asp and Arg, respectively, form a hydrogen bond in the transition state analogue complex in Limulus AK (Zhou et al., 1998) and are key residues for synergism (Suzuki et al., 2000; Takeuchi et al., 2004; Fujimoto et al., 2005). Interestingly, Macrobiotus AK exhibits higher synergism in substrate binding (Kd/Km = 5.78) than do other AKs (Kd/Km = 0.9–3.99; Table 2). In addition, the kcat value (291 s-1) of Macrobiotus AK is also higher than other AKs (1.3–200 s-1; Table 2), except for that (678 s-1) of Anthopleura His-tagged AK, which exhibits an unusual two-domain structure (Tada and Suzuki, 2010). These results indicate that Macrobiotus AK is distinguished from other AKs by its high kcat and Kd/Km values.

We determined preliminary temperature/ activity profiles at pH 8.0 for His-tagged recombinant Macrobiotus AK and Nautilus AK, a well-characterized AK (Fig. 4). Comparison of the profiles indicates that the optimum temperature of Macrobiotus AK appears to be shifted about 10°C to the high temperature region, and maintains higher activity over 35°C, compared with Nautilus AK.

These characteristics of Macrobiotus AK (high kcat and Kd/Km values, and differences in temperature-dependent activity) may be related to the survival of Macrobiotus occidentalis under extreme conditions.

Fig. 4.

Temperature/activity profiles of Macrobiotus AK and Nautilus AK. Profiles represent activity relative to each maximum activity. Activities at pH 8.0 were measured between 10 and 45°C under substrate concentrations of 9.52 mM arginine and 4.76 mM ATP, using His-tagged recombinant enzymes.

f04_796.eps

ACKNOWLEDGEMENTS

This work was supported by a Grant-in-Aid for Scientific Research in Japan to KU (21770080) and to TS (17570062 and 20570072).

Glossary

ABBREVIATIONS

AK

arginine kinase;

CK

creatine kinase;

GK

glycocyamine kinase;

GS

region, guanidine specificity region;

LK

lombricine kinase;

TK

taurocyamine kinase;

EST

expressed sequence tag.

REFERENCES

1.

LD Andrews , J Graham , MJ Snider , D Fraga (2008) Characterization of a novel bacterial arginine kinase from Desulfotalea psychrophila. Comp Biochem Physiol B 150: 312–319 Google Scholar

2.

M Anisimova , O Gascuel (2006) Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative. Syst Biol 55: 539–552 Google Scholar

3.

ND Borson , WL Salo , LR Drewes (1992) A lock-docking oligo(dT) primer for 5′ and 3> RACE PCR. PCR Meth Appl 2: 144–148 Google Scholar

4.

A Brown , SH Grossman (2004) The mechanism and modes of inhibition of arginine kinase from the cockroach (Periplaneta americana). Arch Insect Biochem Physiol 57: 166–177 Google Scholar

5.

P Chomczynski , N Sacchi (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159 Google Scholar

6.

WW Cleland (1979) Statistical analysis of enzyme kinetic data. Method Enzymol 63: 103–138 Google Scholar

7.

DJ Colgan , PA Hutchings , E Beacham (2008) Multi-gene analyses of the phylogenetic relationships among the Mollusca, Annelida, and Arthropoda. Zool Studies 47: 338–351 Google Scholar

8.

CW Dunn , A Hejnol , DQ Matus , K Pang , WE Browne , SA Smith , et al. (2008) Broad phylogenomic sampling improves the resolution of the animal tree of life. Nature 452: 745–749 Google Scholar

9.

WR Ellington (2001) Evolution and physiological roles of Phosphagen systems. Ann Rev Physiol 63: 289–325 Google Scholar

10.

WR Ellington , T Suzuki (2006) Evolution and divergence of creatine kinase genes. In “Molecular Anatomy and Physiology of Proteins: Creatine Kinase” Ed by C Vial , Nova Science, New York pp 1–26 Google Scholar

11.

N Fujimoto , K Tanaka , T Suzuki (2005) Amino acid residues 62 and 193 play the key role in regulating the synergism of substrate binding in oyster arginine kinase. FEBS Lett 579: 1688–1692 Google Scholar

12.

S Guindon , O Gascuel (2003) A simple fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704 Google Scholar

13.

DD Horikawa , T Sakashita , C Katagiri , M Watanabe , T Kikawada , et al. (2006) Radiation tolerance in the tardigrade Milnesium tardigradum. Int J Radiat Biol 82: 843–848 Google Scholar

14.

K Iwanami , S Iseno , K Uda , T Suzuki (2009) A novel arginine kinase from the shrimp Neocaridina denticulata: The fourth arginine kinase gene lineage. Gene 437: 80–87 Google Scholar

15.

BR Jarilla , S Tokuhiro , M Nagataki , SJ Hong , K Uda , T Suzuki , T Agatsuma (2009) Molecular characterization and kinetic properties of a novel two-domain taurocyamine kinase from the lung fluke Paragonimus westermani. FEBS Lett 583: 2218–2224 Google Scholar

16.

KI Jonsson , E Rabbow , RO Schill , M Harms-Ringdahl , P Rettberg (2008) Tardigrades survive exposure to space in low Earth orbit. Curr Biol 18: R729–R731 Google Scholar

17.

M Li , X Wang , J Bai (2006) Purification and characterization of arginine kinase from locust. Protein Pept Lett 13: 405–410 Google Scholar

18.

J Mallatt , G Giribet (2006) Further use of nearly complete 28S and 18S rRNA genes to classify Ecdysozoa: 37 more arthropods and a kinorhynch. Mol Phylogenet Evol 40: 772–794 Google Scholar

19.

JM Mallatt , JR Garey , JW Shultz (2004) Ecdysozoan phylogeny and Bayesian inference: first use of nearly complete 28S and 18S rRNA gene sequences to classify the arthropods and their kin. Mol Phylogenet Evol 31: 178–191 Google Scholar

20.

MJ McLeish , GL Kenyon (2005) Relating structure to mechanism in creatine kinase. Crit Rev Biochem Mol Biol 40: 1–20 Google Scholar

21.

JF Morrison , E James (1965) The mechanism of the reaction catalysed by adenosine triphosphate-creatine phosphotransferase. Biochem J 97: 37–52 Google Scholar

22.

RD Nelson (2002) Current status of the tardigrada: evolution and ecology. Integr Comp Biol 42: 652–659 Google Scholar

23.

H Ramlov , P Westh (2001) Cryptobiosis in the eutardigrade Adorybiotus (Richtersius) coronifer: tolerance to alcohols, temperature and de novo protein synthesis. Zool Anz 240: 517–523 Google Scholar

24.

U Schlattner , M Tokarska-Schlattner , T Wallimann (2006) Mitochondrial creatine kinase in human health and disease. Biochim Biophys Acta 1762: 164–180 Google Scholar

25.

DJ Seals , SH Grossman (1988) Purification and characterization of arginine kinase from the sea cucumber Caudina arenicola. Comp Biochem Physiol B 89: 701–707 Google Scholar

26.

K Seki , M Toyoshima (1998) Preserving tardigrades under pressure. Nature 395: 853–854 Google Scholar

27.

T Suzuki , T Furukohri (1994) Evolution of Phosphagen kinase Primary structure of glycocyamine kinase and arginine kinase from invertebrates. J Mol Biol 237: 353–357 Google Scholar

28.

T Suzuki , Y Kawasaki , T Furukohri (1997) Evolution of Phosphagen kinase: Isolation characterization and cDNA-derived amino acid sequence of two-domain arginine kinase from the sea anemone Anthopleura japonicus. Biochem J 328: 301–306 Google Scholar

29.

T Suzuki , Y Kawasaki , Y Unemi , Y Nishimura , T Soga , M Kamidochi , Y Yazawa , T Furukohri (1998) Gene duplication and fusion have occurred frequently in the evolution of Phosphagen kinases-a two-domain arginine kinase from the clam Pseudocardium sachalinensis. Biochim Biophys Acta 1388: 253–259 Google Scholar

30.

T Suzuki , M Kamidochi , N Inoue , H Kawamichi , Y Yazawa , T Furukohri , WR Ellington (1999) Arginine kinase evolved twice: evidence that echinoderm arginine kinase originated from creatine kinase. Biochem J 340: 671–675 Google Scholar

31.

T Suzuki , H Fukuta , H Nagato , M Umekawa (2000) Arginine kinase from Nautilus pompilius, a living fossil: Site-directed mutagenesis studies on the role of amino acid residues in the Guanidino specificity region. J Biol Chem 275: 23884–23890 Google Scholar

32.

H Tada , T Suzuki (2010) Cooperativity in the two-domain arginine kinase from the sea anemone Anthopleura japonicus. II. Evidence from site-directed mutagenesis studies. Int J Biol Macromol 47: 250–254 Google Scholar

33.

H Tada , Y Nishimura , T Suzuki (2008) Cooperativity in the twodomain arginine kinase from the sea anemone Anthopleura japonicas. Int J Biol Macromol 42: 46–51 Google Scholar

34.

M Takeuchi , C Mizuta , K Uda , N Fujimoto , M Okamoto , T Suzuki (2004) Unique evolution of Bivalvia arginine kinases. Cell Mol Life Sci 61: 110–117 Google Scholar

35.

K Tanaka , S Ichinari , K Iwanami , S Yoshimatsu , T Suzuki (2007) Arginine kinase from the beetle Cissites cephalotes (Olivier). Molecular cloning, phylogenetic analysis and enzymatic properties. Insect Biochem Mol Biol 37: 338–345 Google Scholar

36.

K Uda , T Suzuki (2004) Role of amino acid residues on the GS region of Stichopus arginine kinase and Danio creatine kinase. Protein J 23: 53–64 Google Scholar

37.

K Uda , T Suzuki (2007) A novel arginine kinase with substrate specificity towards D-arginine. Protein J 26: 281–291 Google Scholar

38.

K Uda , A Iwai , T Suzuki (2005) Hypotaurocyamine kinase evolved from a gene for arginine kinase. FEBS Lett 579: 6756–6762 Google Scholar

39.

K Uda , N Fujimoto , Y Akiyama , K Mizuta , K Tanaka , WR Ellington , T Suzuki (2006) Evolution of the arginine kinase gene family. Comp Biochem Physiol D 1: 209–218 Google Scholar

40.

S Wickramasinghe , K Uda , M Nagataki , L Yatawara , RPVJ Rajapakse , Y Watanabe , T Suzuki , T Agatsuma (2007) Toxocara canis: molecular cloning, characterization, expression and comparison of the kinetics of cDNA-derived arginine kinase. Exp Parasitai 117: 124–132 Google Scholar

41.

S Wickramasinghe , L Yatawara , M Nagataki , M Takamoto , Y Watanabe , RPVJ Rajapakse , K Uda , T Suzuki , T Agatsuma (2008) Development of a highly sensitive IgG-ELISA based on recombinant arginine kinase of Toxocara canis for serodiagnosis of visceral larva migrans in the murine model. Parasitai Res 103: 853–858 Google Scholar

42.

QY Wu , F Li , WJ Zhu , XY Wang (2007) Cloning, expression, purification, and characterization of arginine kinase from Locusta migratoria manilensis. Comp Biochem Physiol B Biochem Mol Biol 148: 355–362 Google Scholar

43.

M Wyss , J Smeitink , R Wevers , T Wallimann (1992) Mitochondrial creatine kinase: a key enzyme of aerobic energy metabolism. Biochim Biophys Acta 1102: 119–166 Google Scholar

44.

G Zhou , T Somasundaram , E Blanc , G Parthasarathy , WR Ellington , MS Chapman (1998) Transition state structure of arginine kinase: implications for catalysis of bimolecular reactions. Proc Natl Acad Sci USA 95: 8449–8454 Google Scholar
© 2010 Zoological Society of Japan
Kouji Uda, Mikako Ishida, Tohru Matsui, and Tomohiko Suzuki "Arginine Kinase from the Tardigrade, Macrobiotus occidentalis: Molecular Cloning, Phylogenetic Analysis and Enzymatic Properties," Zoological Science 27(10), 796-803, (1 October 2010). https://doi.org/10.2108/zsj.27.796
Accepted: 2 March 2010; Published: 1 October 2010
JOURNAL ARTICLE
8 PAGES


SHARE
ARTICLE IMPACT
Back to Top